Incidental Mutation 'R1688:Arhgef2'
ID189478
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 2
SynonymsP40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88605966-88648052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88640300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 571 (D571G)
Ref Sequence ENSEMBL: ENSMUSP00000135428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176500] [ENSMUST00000176804] [ENSMUST00000177303] [ENSMUST00000177498]
Predicted Effect probably benign
Transcript: ENSMUST00000029694
AA Change: D579G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: D579G

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107510
AA Change: D552G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: D552G

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170653
AA Change: D550G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: D550G

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175779
AA Change: D564G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: D564G

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175903
AA Change: D562G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: D562G

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175911
AA Change: D571G

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059
AA Change: D571G

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176272
Predicted Effect probably benign
Transcript: ENSMUST00000176500
AA Change: D564G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: D564G

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176804
AA Change: D577G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: D577G

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177099
Predicted Effect probably benign
Transcript: ENSMUST00000177303
AA Change: D550G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: D550G

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177418
Predicted Effect probably benign
Transcript: ENSMUST00000177498
AA Change: D562G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: D562G

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88631919 missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88646220 missense probably damaging 1.00
R0090:Arhgef2 UTSW 3 88639348 missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88642501 missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88632268 splice site probably benign
R0631:Arhgef2 UTSW 3 88634436 missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88639321 critical splice acceptor site probably null
R1751:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1767:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88639459 missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88632915 missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88629791 missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88636044 missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88634416 missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88633033 missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88643878 missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88631940 nonsense probably null
R4733:Arhgef2 UTSW 3 88631940 nonsense probably null
R4837:Arhgef2 UTSW 3 88632943 missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88642462 missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88629568 splice site probably null
R5194:Arhgef2 UTSW 3 88635649 missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88633648 critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88646329 missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88642997 missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88634437 missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88642976 missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88643617 splice site probably null
R5910:Arhgef2 UTSW 3 88635020 missense probably damaging 1.00
R5914:Arhgef2 UTSW 3 88635869 missense probably benign
R5918:Arhgef2 UTSW 3 88636080 missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88635620 missense probably damaging 1.00
R6489:Arhgef2 UTSW 3 88643014 missense probably damaging 1.00
R7167:Arhgef2 UTSW 3 88643872 missense possibly damaging 0.56
R7289:Arhgef2 UTSW 3 88635885 missense probably benign
R7318:Arhgef2 UTSW 3 88632303 missense probably damaging 0.98
R7353:Arhgef2 UTSW 3 88635686 missense possibly damaging 0.94
R7402:Arhgef2 UTSW 3 88633566 missense probably damaging 1.00
V1662:Arhgef2 UTSW 3 88633329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGGACGCAGGCTTCTCATAAC -3'
(R):5'- GGCATTAGATGCCCTTGGGACATAG -3'

Sequencing Primer
(F):5'- CCTTTATAAGCCTGAATGGTAAGTG -3'
(R):5'- gccattagagagccactacac -3'
Posted On2014-05-14