Incidental Mutation 'R1688:Nras'
ID189479
Institutional Source Beutler Lab
Gene Symbol Nras
Ensembl Gene ENSMUSG00000027852
Gene Nameneuroblastoma ras oncogene
SynonymsN-ras
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103058285-103067914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103060373 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 95 (L95P)
Ref Sequence ENSEMBL: ENSMUSP00000143391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029445] [ENSMUST00000029446] [ENSMUST00000128264] [ENSMUST00000196355] [ENSMUST00000197488] [ENSMUST00000197678] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199049] [ENSMUST00000199240] [ENSMUST00000199367] [ENSMUST00000199420] [ENSMUST00000199571] [ENSMUST00000200069] [ENSMUST00000200457]
Predicted Effect probably benign
Transcript: ENSMUST00000029445
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029445
Gene: ENSMUSG00000027852
AA Change: L95P

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029446
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128264
Predicted Effect probably benign
Transcript: ENSMUST00000196355
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142438
Gene: ENSMUSG00000027852
AA Change: L95P

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197488
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197678
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142603
Gene: ENSMUSG00000027852
AA Change: L95P

DomainStartEndE-ValueType
RAS 1 150 4.08e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197827
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197844
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect probably benign
Transcript: ENSMUST00000198180
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199049
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143644
Gene: ENSMUSG00000027852
AA Change: L95P

DomainStartEndE-ValueType
RAS 1 166 5.3e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199367
SMART Domains Protein: ENSMUSP00000143620
Gene: ENSMUSG00000027852

DomainStartEndE-ValueType
small_GTPase 1 74 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199420
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199571
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199776
Predicted Effect probably benign
Transcript: ENSMUST00000200069
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143391
Gene: ENSMUSG00000027852
AA Change: L95P

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200457
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an N-ras oncogene encoding a membrane protein that shuttles between the Golgi apparatus and the plasma membrane. This shuttling is regulated through palmitoylation and depalmitoylation by the ZDHHC9-GOLGA7 complex. The encoded protein, which has intrinsic GTPase activity, is activated by a guanine nucleotide-exchange factor and inactivated by a GTPase activating protein. Mutations in this gene have been associated with somatic rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and juvenile myelomonocytic leukemia. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with no gross morphological or histological abnormalities, or defects in peripheral blood cell populations. Mice homozygous for an LTR insertion in intron 1 exhibit weight loss immune defectsand postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Nras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Nras APN 3 103058916 utr 5 prime probably benign
IGL01443:Nras APN 3 103062435 missense probably benign 0.21
IGL03327:Nras APN 3 103059024 missense probably damaging 1.00
R0697:Nras UTSW 3 103060300 missense possibly damaging 0.89
R1753:Nras UTSW 3 103058979 missense probably damaging 1.00
R2296:Nras UTSW 3 103059034 critical splice donor site probably null
R3977:Nras UTSW 3 103060225 missense probably benign 0.10
R3979:Nras UTSW 3 103060225 missense probably benign 0.10
R6087:Nras UTSW 3 103060321 missense probably damaging 1.00
R6194:Nras UTSW 3 103058953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTGAGCCTGTCCTTGTCCCC -3'
(R):5'- GCCTGCTAACTAAGCCAAGATGCC -3'

Sequencing Primer
(F):5'- CCTCACTCTTTCATATTCCCAGG -3'
(R):5'- AGATGCCCAGGCCCTAAG -3'
Posted On2014-05-14