Incidental Mutation 'R1688:Cacna1g'
ID189511
Institutional Source Beutler Lab
Gene Symbol Cacna1g
Ensembl Gene ENSMUSG00000020866
Gene Namecalcium channel, voltage-dependent, T type, alpha 1G subunit
Synonymsa1G, Cav3.1d
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94408391-94474198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94425953 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1514 (M1514L)
Ref Sequence ENSEMBL: ENSMUSP00000103418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000100561] [ENSMUST00000103166] [ENSMUST00000107785] [ENSMUST00000107786] [ENSMUST00000107788] [ENSMUST00000107789] [ENSMUST00000107790] [ENSMUST00000107791] [ENSMUST00000107792] [ENSMUST00000107793]
Predicted Effect probably benign
Transcript: ENSMUST00000021234
AA Change: M1491L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866
AA Change: M1491L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100561
AA Change: M1514L

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098127
Gene: ENSMUSG00000020866
AA Change: M1514L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
coiled coil region 1542 1582 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
Pfam:Ion_trans 1653 1858 6.2e-49 PFAM
Pfam:PKD_channel 1711 1865 1.4e-10 PFAM
low complexity region 2203 2234 N/A INTRINSIC
low complexity region 2253 2269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103166
AA Change: M1514L

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099455
Gene: ENSMUSG00000020866
AA Change: M1514L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
SCOP:d1g2qa_ 1545 1589 6e-3 SMART
Pfam:Ion_trans 1646 1851 6.2e-49 PFAM
Pfam:PKD_channel 1704 1858 1.4e-10 PFAM
low complexity region 2196 2227 N/A INTRINSIC
low complexity region 2246 2262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107785
AA Change: M1491L

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103414
Gene: ENSMUSG00000020866
AA Change: M1491L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.5e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.7e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 5.8e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2027 2042 N/A INTRINSIC
low complexity region 2084 2115 N/A INTRINSIC
low complexity region 2134 2150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107786
AA Change: M1474L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103415
Gene: ENSMUSG00000020866
AA Change: M1474L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 383 4e-60 PFAM
low complexity region 466 490 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Pfam:Ion_trans 760 946 1.6e-45 PFAM
low complexity region 1023 1034 N/A INTRINSIC
low complexity region 1046 1073 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
Pfam:Ion_trans 1273 1497 5.9e-55 PFAM
SCOP:d1g2qa_ 1505 1549 6e-3 SMART
Pfam:Ion_trans 1606 1811 6e-49 PFAM
Pfam:PKD_channel 1664 1818 1.4e-10 PFAM
low complexity region 2156 2187 N/A INTRINSIC
low complexity region 2206 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107788
AA Change: M1514L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103417
Gene: ENSMUSG00000020866
AA Change: M1514L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1574 N/A INTRINSIC
Pfam:Ion_trans 1628 1833 6.1e-49 PFAM
Pfam:PKD_channel 1686 1840 1.4e-10 PFAM
low complexity region 2178 2209 N/A INTRINSIC
low complexity region 2228 2244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107789
AA Change: M1514L

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103418
Gene: ENSMUSG00000020866
AA Change: M1514L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 80 406 1.6e-76 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 742 972 3.4e-56 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1276 1549 1.5e-61 PFAM
low complexity region 1578 1589 N/A INTRINSIC
Pfam:Ion_trans 1611 1863 2.1e-56 PFAM
Pfam:PKD_channel 1703 1858 3.4e-9 PFAM
low complexity region 2289 2320 N/A INTRINSIC
low complexity region 2339 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107790
AA Change: M1491L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103419
Gene: ENSMUSG00000020866
AA Change: M1491L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
SCOP:d1g2qa_ 1522 1566 6e-3 SMART
Pfam:Ion_trans 1623 1828 6.1e-49 PFAM
Pfam:PKD_channel 1681 1835 1.4e-10 PFAM
low complexity region 2173 2204 N/A INTRINSIC
low complexity region 2223 2239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107791
AA Change: M1491L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103420
Gene: ENSMUSG00000020866
AA Change: M1491L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 6e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2162 2193 N/A INTRINSIC
low complexity region 2212 2228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107792
AA Change: M1491L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103421
Gene: ENSMUSG00000020866
AA Change: M1491L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.9e-55 PFAM
coiled coil region 1519 1551 N/A INTRINSIC
Pfam:Ion_trans 1605 1810 6e-49 PFAM
Pfam:PKD_channel 1663 1817 1.4e-10 PFAM
low complexity region 2155 2186 N/A INTRINSIC
low complexity region 2205 2221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107793
AA Change: M1514L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103422
Gene: ENSMUSG00000020866
AA Change: M1514L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1581 N/A INTRINSIC
Pfam:Ion_trans 1635 1840 6.1e-49 PFAM
Pfam:PKD_channel 1693 1847 1.4e-10 PFAM
low complexity region 2185 2216 N/A INTRINSIC
low complexity region 2235 2251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152811
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice display disrupted sleeping patterns, altered amounts of activity, abnormal action potentials in the brain, prolonged electrical conductance in the heart, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Klk1b8 T A 7: 43,945,805 probably benign Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Cacna1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Cacna1g APN 11 94433912 missense probably benign 0.16
IGL01382:Cacna1g APN 11 94465858 missense probably damaging 1.00
IGL01694:Cacna1g APN 11 94429112 missense probably damaging 1.00
IGL01866:Cacna1g APN 11 94457111 missense probably damaging 0.99
IGL02341:Cacna1g APN 11 94462152 missense probably damaging 1.00
IGL02506:Cacna1g APN 11 94429129 missense probably damaging 0.99
IGL02706:Cacna1g APN 11 94456992 missense probably damaging 1.00
IGL02879:Cacna1g APN 11 94409605 missense probably benign 0.12
IGL03366:Cacna1g APN 11 94457151 missense probably damaging 1.00
ANU23:Cacna1g UTSW 11 94466228 critical splice acceptor site probably benign
IGL03134:Cacna1g UTSW 11 94459825 missense probably damaging 1.00
R0092:Cacna1g UTSW 11 94457264 missense probably damaging 1.00
R0123:Cacna1g UTSW 11 94409476 missense probably damaging 1.00
R0178:Cacna1g UTSW 11 94463483 missense probably damaging 1.00
R0375:Cacna1g UTSW 11 94411054 missense possibly damaging 0.79
R0389:Cacna1g UTSW 11 94459697 missense probably damaging 1.00
R0433:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R0458:Cacna1g UTSW 11 94409440 missense probably damaging 0.96
R0498:Cacna1g UTSW 11 94459859 missense probably damaging 1.00
R0629:Cacna1g UTSW 11 94409543 missense possibly damaging 0.93
R0800:Cacna1g UTSW 11 94426439 missense probably damaging 1.00
R1341:Cacna1g UTSW 11 94433756 missense probably damaging 0.99
R1457:Cacna1g UTSW 11 94459555 missense possibly damaging 0.76
R1523:Cacna1g UTSW 11 94442729 critical splice donor site probably null
R1532:Cacna1g UTSW 11 94443331 missense probably damaging 1.00
R1540:Cacna1g UTSW 11 94457039 missense probably damaging 1.00
R1652:Cacna1g UTSW 11 94427404 missense probably damaging 1.00
R1750:Cacna1g UTSW 11 94443292 missense probably damaging 1.00
R1751:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1767:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1847:Cacna1g UTSW 11 94466181 missense probably damaging 1.00
R1924:Cacna1g UTSW 11 94444054 missense possibly damaging 0.93
R1973:Cacna1g UTSW 11 94459777 missense possibly damaging 0.86
R2050:Cacna1g UTSW 11 94409474 missense probably damaging 1.00
R2261:Cacna1g UTSW 11 94457135 missense probably benign 0.42
R2273:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2274:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2275:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2376:Cacna1g UTSW 11 94465908 missense probably damaging 0.99
R3686:Cacna1g UTSW 11 94459090 splice site probably null
R3809:Cacna1g UTSW 11 94416096 missense probably damaging 1.00
R3875:Cacna1g UTSW 11 94437923 missense probably damaging 0.98
R4133:Cacna1g UTSW 11 94432544 missense probably damaging 1.00
R4642:Cacna1g UTSW 11 94418094 missense probably damaging 1.00
R4732:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4733:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4773:Cacna1g UTSW 11 94411472 missense possibly damaging 0.78
R4798:Cacna1g UTSW 11 94433847 missense probably damaging 1.00
R4839:Cacna1g UTSW 11 94459607 missense probably benign 0.16
R4900:Cacna1g UTSW 11 94459351 missense possibly damaging 0.78
R4927:Cacna1g UTSW 11 94429147 missense probably damaging 1.00
R4930:Cacna1g UTSW 11 94444073 missense probably damaging 1.00
R5050:Cacna1g UTSW 11 94459715 missense probably damaging 1.00
R5117:Cacna1g UTSW 11 94432503 missense probably damaging 1.00
R5186:Cacna1g UTSW 11 94442848 missense probably damaging 1.00
R5364:Cacna1g UTSW 11 94416858 missense probably benign 0.29
R5512:Cacna1g UTSW 11 94444142 missense probably damaging 1.00
R5564:Cacna1g UTSW 11 94430486 missense probably damaging 1.00
R5603:Cacna1g UTSW 11 94439752 missense possibly damaging 0.76
R5682:Cacna1g UTSW 11 94459114 missense probably damaging 1.00
R5818:Cacna1g UTSW 11 94418120 missense probably damaging 1.00
R5828:Cacna1g UTSW 11 94457154 missense probably damaging 1.00
R5882:Cacna1g UTSW 11 94459819 missense probably damaging 1.00
R5884:Cacna1g UTSW 11 94437867 missense probably damaging 1.00
R6075:Cacna1g UTSW 11 94416665 missense probably damaging 1.00
R6112:Cacna1g UTSW 11 94409246 missense probably damaging 0.98
R6122:Cacna1g UTSW 11 94430171 missense probably benign 0.11
R6145:Cacna1g UTSW 11 94462261 missense probably damaging 1.00
R6362:Cacna1g UTSW 11 94439707 critical splice donor site probably null
R6415:Cacna1g UTSW 11 94463417 missense probably damaging 1.00
R6468:Cacna1g UTSW 11 94439722 missense probably damaging 1.00
R6648:Cacna1g UTSW 11 94432569 missense probably damaging 1.00
R6746:Cacna1g UTSW 11 94409427 nonsense probably null
R6764:Cacna1g UTSW 11 94413188 missense possibly damaging 0.95
R6782:Cacna1g UTSW 11 94459550 missense probably damaging 1.00
R6888:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R7148:Cacna1g UTSW 11 94465930 missense probably benign 0.32
R7181:Cacna1g UTSW 11 94415865 missense probably benign 0.21
R7183:Cacna1g UTSW 11 94439737 missense probably benign 0.04
R7193:Cacna1g UTSW 11 94409231 missense possibly damaging 0.60
R7237:Cacna1g UTSW 11 94437879 missense probably benign 0.21
R7254:Cacna1g UTSW 11 94432567 nonsense probably null
R7312:Cacna1g UTSW 11 94432557 missense probably damaging 1.00
X0001:Cacna1g UTSW 11 94409645 missense possibly damaging 0.90
X0019:Cacna1g UTSW 11 94459253 missense probably damaging 0.97
X0065:Cacna1g UTSW 11 94462425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGCAGGCTCTAAAGGCGG -3'
(R):5'- TGATGCCAGCTCATTCCAGCTC -3'

Sequencing Primer
(F):5'- CTCTAAAGGCGGACATGCTATTG -3'
(R):5'- GCTCATTCCAGCTCATCCCAG -3'
Posted On2014-05-14