Incidental Mutation 'R1689:B020004J07Rik'
ID189558
Institutional Source Beutler Lab
Gene Symbol B020004J07Rik
Ensembl Gene ENSMUSG00000035201
Gene NameRIKEN cDNA B020004J07 gene
Synonyms
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101834969-101844023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101837179 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 169 (K169I)
Ref Sequence ENSEMBL: ENSMUSP00000102532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084386] [ENSMUST00000106919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084386
AA Change: K169I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081421
Gene: ENSMUSG00000035201
AA Change: K169I

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106919
AA Change: K169I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102532
Gene: ENSMUSG00000035201
AA Change: K169I

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in B020004J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:B020004J07Rik APN 4 101835532 missense probably benign
IGL01615:B020004J07Rik APN 4 101837004 missense possibly damaging 0.63
IGL01765:B020004J07Rik APN 4 101837852 missense probably benign 0.03
IGL02228:B020004J07Rik APN 4 101836858 missense probably benign 0.03
IGL02276:B020004J07Rik APN 4 101838109 missense possibly damaging 0.89
IGL02548:B020004J07Rik APN 4 101835573 missense probably damaging 0.99
IGL03226:B020004J07Rik APN 4 101835397 missense probably benign 0.00
R0124:B020004J07Rik UTSW 4 101835373 makesense probably null
R0449:B020004J07Rik UTSW 4 101836961 missense probably benign 0.01
R0573:B020004J07Rik UTSW 4 101835414 missense probably damaging 0.96
R1159:B020004J07Rik UTSW 4 101838027 missense possibly damaging 0.54
R1857:B020004J07Rik UTSW 4 101835573 missense probably damaging 1.00
R1861:B020004J07Rik UTSW 4 101836938 missense probably benign
R2570:B020004J07Rik UTSW 4 101837246 missense probably benign 0.01
R3886:B020004J07Rik UTSW 4 101835723 missense probably benign 0.09
R4922:B020004J07Rik UTSW 4 101835532 missense probably benign
R4984:B020004J07Rik UTSW 4 101835599 missense possibly damaging 0.63
R5503:B020004J07Rik UTSW 4 101835802 missense probably benign 0.00
R6230:B020004J07Rik UTSW 4 101837214 missense probably damaging 0.96
R6831:B020004J07Rik UTSW 4 101836897 missense probably benign 0.26
R7172:B020004J07Rik UTSW 4 101836996 missense probably benign 0.00
R7201:B020004J07Rik UTSW 4 101838141 critical splice acceptor site probably null
R7220:B020004J07Rik UTSW 4 101837368 missense probably benign 0.00
R7253:B020004J07Rik UTSW 4 101835528 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCCCACTAATGCTCCAAGTAAAGG -3'
(R):5'- TGGAAAACAGAATGCCATCTGCCC -3'

Sequencing Primer
(F):5'- GGCACCATTCATATAGACATGCTG -3'
(R):5'- AAGGCAGTGTTTGCAGGTAG -3'
Posted On2014-05-14