Incidental Mutation 'R1689:Abcc8'
ID189572
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R1689 (G1)
Quality Score115
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46120403 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 896 (K896R)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: K896R

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: K896R

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: K217R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211767
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTGCACAAAACCACTTAGGAC -3'
(R):5'- ACTGAGACATTTGAGCCCCAGAGAG -3'

Sequencing Primer
(F):5'- TGTGGCTATCAGCCATTGC -3'
(R):5'- agagaggttaggtgggtgg -3'
Posted On2014-05-14