Incidental Mutation 'R1689:L3hypdh'
ID189591
Institutional Source Beutler Lab
Gene Symbol L3hypdh
Ensembl Gene ENSMUSG00000019718
Gene NameL-3-hydroxyproline dehydratase (trans-)
Synonyms
MMRRC Submission 039722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72073428-72085439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72084753 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 135 (I135N)
Ref Sequence ENSEMBL: ENSMUSP00000019862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019862] [ENSMUST00000057257] [ENSMUST00000117449] [ENSMUST00000125764]
Predicted Effect probably damaging
Transcript: ENSMUST00000019862
AA Change: I135N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019862
Gene: ENSMUSG00000019718
AA Change: I135N

DomainStartEndE-ValueType
Pfam:Pro_racemase 22 352 8.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057257
SMART Domains Protein: ENSMUSP00000061370
Gene: ENSMUSG00000005078

DomainStartEndE-ValueType
Pfam:DUF766 9 300 3.6e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117449
SMART Domains Protein: ENSMUSP00000113744
Gene: ENSMUSG00000005078

DomainStartEndE-ValueType
Pfam:DUF766 3 295 2.3e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124405
Predicted Effect probably benign
Transcript: ENSMUST00000125764
SMART Domains Protein: ENSMUSP00000117251
Gene: ENSMUSG00000005078

DomainStartEndE-ValueType
Pfam:DUF766 10 214 2.2e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152381
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dehydratase that converts trans-3-hydroxy-L-proline to delta(1)-pyrroline-2-carboxylate. This enzyme may function to degrade dietary proteins that contain trans-3-hydroxy-L-proline as well as other proteins such as collagen IV. The encoded protein can be converted to an epimerase by changing a threonine to a cysteine at a catalytic site. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Adgre1 T C 17: 57,449,921 F726S probably benign Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in L3hypdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:L3hypdh APN 12 72077143 critical splice donor site probably null
IGL02718:L3hypdh APN 12 72084856 missense probably damaging 1.00
R0128:L3hypdh UTSW 12 72077143 critical splice donor site probably null
R1109:L3hypdh UTSW 12 72073996 missense possibly damaging 0.93
R2080:L3hypdh UTSW 12 72079527 missense probably damaging 0.96
R2274:L3hypdh UTSW 12 72084858 missense possibly damaging 0.95
R4003:L3hypdh UTSW 12 72085116 missense probably benign 0.00
R4358:L3hypdh UTSW 12 72077424 missense probably damaging 1.00
R4760:L3hypdh UTSW 12 72077242 missense probably benign 0.05
R4825:L3hypdh UTSW 12 72077393 missense probably benign 0.00
R5926:L3hypdh UTSW 12 72077185 missense probably damaging 1.00
X0028:L3hypdh UTSW 12 72079494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGACAGCAGAATTGCATCCAC -3'
(R):5'- TCGCTACATGCGTCAACACCTC -3'

Sequencing Primer
(F):5'- TTTATTAATCGCAAGGGCAGGC -3'
(R):5'- GACATGTACGGGGCCATC -3'
Posted On2014-05-14