Incidental Mutation 'R1689:Adgre1'
ID189609
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 039722-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1689 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57449921 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 726 (F726S)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: F726S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: F726S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: F726S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: F726S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,120,403 K896R probably benign Het
Adcy9 A T 16: 4,297,562 probably null Het
Ahctf1 A T 1: 179,768,383 S148T probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ammecr1l C A 18: 31,780,688 A289D probably benign Het
Amotl1 T C 9: 14,593,222 Y230C probably damaging Het
Armc6 A T 8: 70,229,537 S65R probably benign Het
Atad2b T A 12: 5,034,575 Y1440* probably null Het
Atf6b T A 17: 34,650,302 D164E probably damaging Het
B020004J07Rik T A 4: 101,837,179 K169I possibly damaging Het
B4galt6 C T 18: 20,706,496 S127N probably benign Het
Bcl11a A T 11: 24,163,167 Y170F probably damaging Het
Bcl11a A T 11: 24,164,406 D583V possibly damaging Het
Btnl1 T A 17: 34,381,208 Y228* probably null Het
C130060K24Rik A G 6: 65,381,607 N105S possibly damaging Het
Cav2 A G 6: 17,281,422 H21R probably benign Het
Celsr2 T A 3: 108,407,304 D1135V possibly damaging Het
Cntnap1 A C 11: 101,188,873 probably null Het
Cysltr2 T C 14: 73,030,030 D80G possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkh A T 14: 78,618,544 M363K possibly damaging Het
Eml5 C T 12: 98,830,935 V1112M probably damaging Het
Entpd7 A G 19: 43,725,476 T425A probably damaging Het
Ephx2 T A 14: 66,087,026 K373* probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbxw10 A T 11: 62,860,036 I482L probably damaging Het
Fbxw8 T C 5: 118,077,617 S443G probably damaging Het
Fdft1 T C 14: 63,156,689 E191G probably benign Het
Fgd2 A G 17: 29,363,722 E26G probably benign Het
Gabra4 T C 5: 71,633,542 probably null Het
Gc A G 5: 89,441,200 probably null Het
Heatr1 T A 13: 12,424,625 D1361E probably benign Het
Hid1 A G 11: 115,360,357 F118L probably damaging Het
Igsf8 G T 1: 172,318,937 G564W probably damaging Het
Il12rb2 A G 6: 67,336,760 V4A probably benign Het
Irak3 T C 10: 120,146,552 E335G probably damaging Het
Itgb8 T G 12: 119,170,820 Q504P probably benign Het
Kbtbd12 A T 6: 88,618,585 Y88N probably damaging Het
Klk1b5 T C 7: 44,220,545 I226T probably damaging Het
L3hypdh A T 12: 72,084,753 I135N probably damaging Het
Lrp2 G T 2: 69,503,529 T1456K probably benign Het
Mrgprd C A 7: 145,321,717 Y108* probably null Het
Muc6 C T 7: 141,647,998 G742D probably damaging Het
Nalcn T A 14: 123,285,254 I1572F probably damaging Het
Nceh1 A G 3: 27,226,082 Y126C probably damaging Het
Olfr125 T C 17: 37,835,604 S202P possibly damaging Het
Olfr356 A G 2: 36,937,977 N286S probably damaging Het
Olfr867 A T 9: 20,055,126 N112K possibly damaging Het
Pacs1 G T 19: 5,272,615 probably benign Het
Pappa2 A G 1: 158,957,398 L14P probably damaging Het
Pdlim2 C T 14: 70,171,239 G176D probably damaging Het
Ptpra T C 2: 130,503,492 F5L probably benign Het
Ralgapa1 A G 12: 55,676,767 L2114P possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Senp2 T A 16: 22,026,666 Y217N probably damaging Het
Sned1 C T 1: 93,283,372 R1061C probably damaging Het
Spag16 C T 1: 70,461,118 T535I probably benign Het
Supt20 T A 3: 54,712,162 L355* probably null Het
Tmem132b A G 5: 125,787,614 H928R possibly damaging Het
Tpo A T 12: 30,098,246 L552H probably damaging Het
Tsfm A T 10: 127,028,455 N130K probably damaging Het
Usp48 T A 4: 137,656,107 probably null Het
Vsig10 A G 5: 117,352,760 D544G probably benign Het
Vsig10l C T 7: 43,465,368 T433I possibly damaging Het
Wdr81 A G 11: 75,445,596 F1655L probably damaging Het
Wfdc3 T A 2: 164,734,191 D60V probably damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAAGAAGTACACTTGGAGTCCC -3'
(R):5'- CTCACCGATTATGCATCCCATAGCC -3'

Sequencing Primer
(F):5'- TCACTCATCCTAGATGGTGAAGG -3'
(R):5'- GCATCCCATAGCCCCGTG -3'
Posted On2014-05-14