Incidental Mutation 'R1700:Usp21'
ID189620
Institutional Source Beutler Lab
Gene Symbol Usp21
Ensembl Gene ENSMUSG00000053483
Gene Nameubiquitin specific peptidase 21
SynonymsUsp23, W53272, ESTM28, Usp16
MMRRC Submission 039733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1700 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171281945-171287991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 171283722 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 379 (L379F)
Ref Sequence ENSEMBL: ENSMUSP00000120161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000080001] [ENSMUST00000111302] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000144576] [ENSMUST00000149187] [ENSMUST00000192956]
Predicted Effect probably damaging
Transcript: ENSMUST00000065941
AA Change: L379F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080001
SMART Domains Protein: ENSMUSP00000078914
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 4 164 1.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111302
SMART Domains Protein: ENSMUSP00000106933
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 6 160 1.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111305
AA Change: L379F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111306
AA Change: L382F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483
AA Change: L382F

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144393
Predicted Effect probably benign
Transcript: ENSMUST00000144576
SMART Domains Protein: ENSMUSP00000137977
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 4 91 2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147176
Predicted Effect probably damaging
Transcript: ENSMUST00000149187
AA Change: L379F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000174720
SMART Domains Protein: ENSMUSP00000133362
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
Pfam:UCH 77 162 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but develop splenomegaly, show an increased percentage of macrophages and neutrophils in spleen, and are more resistant to vesicular stomatitis virus (VSV) infection with elevated interferon production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,709,938 L1010F probably damaging Het
Abcb1b T C 5: 8,849,537 F936L probably benign Het
Adamts12 T A 15: 11,152,057 I211N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alas1 C T 9: 106,239,646 V293I possibly damaging Het
Ap1g1 T C 8: 109,853,612 Y569H probably damaging Het
Apc2 A G 10: 80,312,769 D1190G probably damaging Het
Astn2 G A 4: 65,746,354 Q679* probably null Het
Atp2a1 T A 7: 126,462,909 H5L probably damaging Het
Baiap3 T C 17: 25,249,328 K279E probably damaging Het
C2cd2l G A 9: 44,316,612 P111S probably benign Het
C7 T A 15: 5,002,792 K646* probably null Het
Ccp110 C T 7: 118,735,313 T1003I probably damaging Het
Cdh22 T C 2: 165,170,796 D123G probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clip1 A G 5: 123,630,370 V722A probably benign Het
Cpsf4l A G 11: 113,702,075 F174S probably benign Het
Ctnna3 T C 10: 63,852,772 C332R probably damaging Het
Cxcl10 A T 5: 92,347,855 N76K probably damaging Het
Dnaja3 G A 16: 4,684,165 R11K probably null Het
Efcab10 A G 12: 33,395,171 T28A possibly damaging Het
Esrrg A G 1: 188,043,653 R103G probably damaging Het
Exosc2 A G 2: 31,670,806 K23E probably benign Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fsip2 T C 2: 82,991,737 V5938A probably benign Het
Gclc A G 9: 77,776,289 T143A probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gucy2e A T 11: 69,232,058 M497K probably benign Het
Herc1 T A 9: 66,450,678 probably null Het
Hnrnpll A C 17: 80,034,105 S502A probably benign Het
Ipo11 G T 13: 106,795,662 T975N probably benign Het
Kif17 C T 4: 138,262,698 Q66* probably null Het
Lrp10 T C 14: 54,469,752 V682A possibly damaging Het
Lsmem1 A T 12: 40,180,678 L75Q probably damaging Het
Med16 A T 10: 79,899,335 Y430N probably benign Het
Med8 C T 4: 118,412,734 S72L possibly damaging Het
Mex3a A G 3: 88,536,375 T253A probably damaging Het
Myf6 T C 10: 107,493,359 K242E probably damaging Het
Ncald T A 15: 37,397,343 Y31F probably benign Het
Ndufa12 T A 10: 94,199,993 Y48N probably damaging Het
Olfr1111 T G 2: 87,149,779 N294T probably damaging Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr638 T A 7: 104,004,122 Y282* probably null Het
Pde4dip T C 3: 97,703,323 T1858A probably benign Het
Pgbd1 A G 13: 21,434,481 L2P probably damaging Het
Piezo1 C T 8: 122,487,502 R1642H probably damaging Het
Plxna1 A T 6: 89,357,008 M213K probably damaging Het
Polr1b A G 2: 129,123,121 N709S probably damaging Het
Pramel1 T A 4: 143,398,429 W308R probably damaging Het
Prkag2 A T 5: 24,871,541 I208N probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rngtt T A 4: 33,330,864 F156I probably damaging Het
Rpusd3 A G 6: 113,415,533 *345Q probably null Het
Rrp1b A G 17: 32,057,204 K575R probably benign Het
Shd G A 17: 55,974,307 V250I probably damaging Het
Slc12a5 C A 2: 164,992,376 N749K possibly damaging Het
Sorbs2 T A 8: 45,800,984 V488D probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Srsf4 C A 4: 131,900,560 probably benign Het
Strn T C 17: 78,692,402 Y135C probably damaging Het
Synm T C 7: 67,759,628 M1V probably null Het
Tas1r3 T G 4: 155,861,570 Q489P probably benign Het
Tas2r103 A T 6: 133,036,811 N97K probably damaging Het
Tas2r113 A G 6: 132,893,792 Y261C possibly damaging Het
Tex21 T C 12: 76,221,672 E112G probably damaging Het
Trappc8 T C 18: 20,832,998 S1128G probably damaging Het
Ubap1l A G 9: 65,371,743 probably benign Het
Ubash3a A G 17: 31,215,044 D121G probably damaging Het
Ubxn4 A G 1: 128,252,286 I56V possibly damaging Het
Uri1 T C 7: 37,963,524 I348M probably damaging Het
Vmn1r159 T A 7: 22,842,965 H214L probably damaging Het
Zdbf2 A G 1: 63,302,741 E93G unknown Het
Other mutations in Usp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Usp21 APN 1 171283402 missense probably damaging 0.96
IGL01726:Usp21 APN 1 171284001 missense probably damaging 1.00
IGL01915:Usp21 APN 1 171282733 missense possibly damaging 0.92
IGL02504:Usp21 APN 1 171285023 missense probably benign 0.39
IGL02646:Usp21 APN 1 171283095 unclassified probably benign
R0513:Usp21 UTSW 1 171283012 unclassified probably benign
R0513:Usp21 UTSW 1 171283014 unclassified probably benign
R0570:Usp21 UTSW 1 171283746 unclassified probably benign
R1582:Usp21 UTSW 1 171283081 missense probably damaging 1.00
R4061:Usp21 UTSW 1 171285401 unclassified probably benign
R4073:Usp21 UTSW 1 171282172 unclassified probably benign
R5914:Usp21 UTSW 1 171282171 unclassified probably benign
R6879:Usp21 UTSW 1 171282503 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGAAGCAATCCCGCAAAG -3'
(R):5'- GCCAGATGCCAAGGATGTAAAATGC -3'

Sequencing Primer
(F):5'- tttttaaatCCAGGCTTTAATTCTGC -3'
(R):5'- CCAAGGATGTAAAATGCTGTGTG -3'
Posted On2014-05-14