Incidental Mutation 'R1701:Slc35f5'
ID189697
Institutional Source Beutler Lab
Gene Symbol Slc35f5
Ensembl Gene ENSMUSG00000026342
Gene Namesolute carrier family 35, member F5
Synonyms1300003P13Rik
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location125560595-125595820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125570593 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 176 (E176G)
Ref Sequence ENSEMBL: ENSMUSP00000027580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027580] [ENSMUST00000190037]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027580
AA Change: E176G

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027580
Gene: ENSMUSG00000026342
AA Change: E176G

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
transmembrane domain 69 86 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
Pfam:EamA 226 317 2.1e-8 PFAM
transmembrane domain 329 348 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 397 419 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190037
SMART Domains Protein: ENSMUSP00000139639
Gene: ENSMUSG00000026342

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 123 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Slc35f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc35f5 APN 1 125587424 missense probably damaging 1.00
IGL01844:Slc35f5 APN 1 125589875 missense probably damaging 0.96
IGL02218:Slc35f5 APN 1 125584555 missense probably damaging 1.00
IGL02586:Slc35f5 APN 1 125584536 missense probably damaging 1.00
IGL03000:Slc35f5 APN 1 125574742 missense probably damaging 1.00
IGL03160:Slc35f5 APN 1 125574735 missense probably damaging 1.00
IGL03181:Slc35f5 APN 1 125585185 missense probably damaging 1.00
IGL02984:Slc35f5 UTSW 1 125562513 missense probably benign 0.28
R0127:Slc35f5 UTSW 1 125576205 missense probably damaging 1.00
R0390:Slc35f5 UTSW 1 125585095 missense probably damaging 1.00
R0513:Slc35f5 UTSW 1 125576169 splice site probably benign
R1716:Slc35f5 UTSW 1 125584532 missense possibly damaging 0.65
R2211:Slc35f5 UTSW 1 125579264 missense possibly damaging 0.74
R3024:Slc35f5 UTSW 1 125568598 missense probably benign 0.00
R3870:Slc35f5 UTSW 1 125562361 missense probably benign 0.00
R4239:Slc35f5 UTSW 1 125572474 missense possibly damaging 0.94
R4547:Slc35f5 UTSW 1 125572382 missense probably benign 0.00
R5622:Slc35f5 UTSW 1 125589956 missense probably damaging 1.00
R5688:Slc35f5 UTSW 1 125591038 missense probably benign 0.23
R5876:Slc35f5 UTSW 1 125587363 critical splice acceptor site probably null
R6701:Slc35f5 UTSW 1 125562610 missense probably damaging 1.00
R7292:Slc35f5 UTSW 1 125572485 missense probably damaging 0.99
R7368:Slc35f5 UTSW 1 125584519 missense probably damaging 1.00
R7530:Slc35f5 UTSW 1 125584538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGTTCCTTTGTGTCCCTGTGC -3'
(R):5'- TCAGAAGACTGAAGGCCATGTCAAC -3'

Sequencing Primer
(F):5'- CCCTGTGCCTATGTGGACTG -3'
(R):5'- GGCCATGTCAACCCCCAC -3'
Posted On2014-05-14