Incidental Mutation 'R1701:Soga1'
ID189702
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157030619 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 936 (N936S)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably damaging
Transcript: ENSMUST00000069098
AA Change: N936S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: N936S

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAAGCATCCACAGACCCTGTGTCC -3'
(R):5'- GTTCAAGCACAACTTTCTGCTGCTC -3'

Sequencing Primer
(F):5'- TCCTGTCAGGGCTGAGAAG -3'
(R):5'- CCAGCGAAGAGGATGACTTCC -3'
Posted On2014-05-14