Incidental Mutation 'R1701:Ube3c'
ID189710
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29601202 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 281 (V281I)
Ref Sequence ENSEMBL: ENSMUSP00000142474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453] [ENSMUST00000199032]
Predicted Effect probably benign
Transcript: ENSMUST00000049453
AA Change: V281I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000
AA Change: V281I

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197953
Predicted Effect probably benign
Transcript: ENSMUST00000199032
AA Change: V281I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142474
Gene: ENSMUSG00000039000
AA Change: V281I

DomainStartEndE-ValueType
IQ 44 66 8e-6 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0099:Ube3c UTSW 5 29607064 missense probably damaging 1.00
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R2962:Ube3c UTSW 5 29658418 missense possibly damaging 0.81
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3764:Ube3c UTSW 5 29637586 splice site probably benign
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5059:Ube3c UTSW 5 29631295 missense probably null 0.11
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5140:Ube3c UTSW 5 29635711 missense probably damaging 1.00
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACGTATAGCTCCTGTCCTGAAGCC -3'
(R):5'- GCTGAGGGATAACCCACATCTTGC -3'

Sequencing Primer
(F):5'- TGTCCTGAAGCCTCAAGGTG -3'
(R):5'- TGAAATGACTCATCTGCTCAGC -3'
Posted On2014-05-14