Incidental Mutation 'R1701:Olfr642'
ID189723
Institutional Source Beutler Lab
Gene Symbol Olfr642
Ensembl Gene ENSMUSG00000049797
Gene Nameolfactory receptor 642
SynonymsMOR13-6, GA_x6K02T2PBJ9-6784380-6783436
MMRRC Submission 039734-MU
Accession Numbers

Genbank: NM_146329.1

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104046529-104052666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104050195 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 53 (E53G)
Ref Sequence ENSEMBL: ENSMUSP00000148961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052660] [ENSMUST00000074064] [ENSMUST00000138055] [ENSMUST00000214299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052660
AA Change: E53G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061462
Gene: ENSMUSG00000049797
AA Change: E53G

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.5e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.7e-7 PFAM
Pfam:7tm_1 43 294 4.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074064
SMART Domains Protein: ENSMUSP00000073707
Gene: ENSMUSG00000090219

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2.6e-124 PFAM
Pfam:7TM_GPCR_Srsx 37 255 3.1e-7 PFAM
Pfam:7tm_1 43 294 3.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214299
AA Change: E53G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad54l2 A G 9: 106,700,493 probably null Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Olfr642
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Olfr642 APN 7 104050169 missense probably damaging 1.00
IGL01933:Olfr642 APN 7 104049814 missense probably damaging 1.00
IGL01980:Olfr642 APN 7 104050093 missense probably benign 0.21
IGL02161:Olfr642 APN 7 104049590 missense possibly damaging 0.66
IGL02639:Olfr642 APN 7 104049781 missense probably damaging 0.99
I2289:Olfr642 UTSW 7 104049754 missense probably damaging 1.00
R0418:Olfr642 UTSW 7 104049772 missense probably benign 0.00
R1647:Olfr642 UTSW 7 104050169 missense probably damaging 1.00
R1648:Olfr642 UTSW 7 104050169 missense probably damaging 1.00
R2142:Olfr642 UTSW 7 104050300 missense probably damaging 1.00
R2165:Olfr642 UTSW 7 104049638 missense probably benign 0.22
R2655:Olfr642 UTSW 7 104049431 missense probably benign 0.03
R6216:Olfr642 UTSW 7 104049695 missense probably damaging 1.00
R6759:Olfr642 UTSW 7 104050127 missense probably damaging 1.00
R6925:Olfr642 UTSW 7 104049740 missense probably benign 0.16
R7243:Olfr642 UTSW 7 104049755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCGGATGATGATGGACATACC -3'
(R):5'- TTGAGACTCTTGCTGGACCCACTC -3'

Sequencing Primer
(F):5'- GGTTACAGATAGCCACGTACCG -3'
(R):5'- GCTGGACCCACTCTTCAC -3'
Posted On2014-05-14