Incidental Mutation 'R1702:Golga2'
ID189765
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Namegolgi autoantigen, golgin subfamily a, 2
SynonymsGM130
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32287384-32307921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32299275 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 273 (S273T)
Ref Sequence ENSEMBL: ENSMUSP00000109004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081670] [ENSMUST00000100194] [ENSMUST00000113377] [ENSMUST00000129193] [ENSMUST00000139494]
Predicted Effect probably damaging
Transcript: ENSMUST00000081670
AA Change: S230T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546
AA Change: S230T

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100194
AA Change: S300T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546
AA Change: S300T

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113377
AA Change: S273T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546
AA Change: S273T

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127276
Predicted Effect probably damaging
Transcript: ENSMUST00000129193
AA Change: S232T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546
AA Change: S232T

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131712
AA Change: S207T
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546
AA Change: S207T

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139494
SMART Domains Protein: ENSMUSP00000117476
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 55 61 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146544
Predicted Effect unknown
Transcript: ENSMUST00000147707
AA Change: S260T
SMART Domains Protein: ENSMUSP00000121886
Gene: ENSMUSG00000002546
AA Change: S260T

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
coiled coil region 165 205 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149141
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 unclassified probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1777:Golga2 UTSW 2 32305470 splice site probably null
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4783:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5103:Golga2 UTSW 2 32303746 missense probably benign 0.09
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R5921:Golga2 UTSW 2 32297755 missense probably benign 0.00
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCAGAATTACAGACGGCCCTG -3'
(R):5'- TGTTCAGAGATGAGCACCCATCCC -3'

Sequencing Primer
(F):5'- TGGCCCACACTCAGCAAG -3'
(R):5'- AGCAGGCACCTGCCTTTAG -3'
Posted On2014-05-14