Incidental Mutation 'R1702:Cntrl'
ID189766
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R1702 (G1)
Quality Score149
Status Not validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 35171836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933]
Predicted Effect probably null
Transcript: ENSMUST00000028237
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113032
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113034
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113037
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136047
SMART Domains Protein: ENSMUSP00000123185
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 6 171 N/A INTRINSIC
coiled coil region 203 697 N/A INTRINSIC
low complexity region 735 750 N/A INTRINSIC
coiled coil region 779 801 N/A INTRINSIC
low complexity region 831 849 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142757
SMART Domains Protein: ENSMUSP00000123300
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 6 171 N/A INTRINSIC
coiled coil region 203 697 N/A INTRINSIC
low complexity region 735 750 N/A INTRINSIC
coiled coil region 779 801 N/A INTRINSIC
low complexity region 831 849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143807
Predicted Effect probably null
Transcript: ENSMUST00000156933
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.04
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.04
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense not run
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site unknown
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACACAGTGTCAGCAGCCGAAG -3'
(R):5'- TGCATGTGTCAAGTCGGGTAAACG -3'

Sequencing Primer
(F):5'- GCGAAACTTTCTTGAGCCTG -3'
(R):5'- AACACTCACCAGGAGGTTTTTC -3'
Posted On2014-05-14