Incidental Mutation 'R1702:Deaf1'
ID189808
Institutional Source Beutler Lab
Gene Symbol Deaf1
Ensembl Gene ENSMUSG00000058886
Gene NameDEAF1, transcription factor
SynonymsC230009B13Rik, suppressin, NUDR
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141297180-141327690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 141314954 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 303 (R303T)
Ref Sequence ENSEMBL: ENSMUSP00000147728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080553] [ENSMUST00000209397] [ENSMUST00000210816] [ENSMUST00000210830] [ENSMUST00000211146] [ENSMUST00000211537]
Predicted Effect probably damaging
Transcript: ENSMUST00000080553
AA Change: R303T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886
AA Change: R303T

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209397
Predicted Effect probably benign
Transcript: ENSMUST00000209600
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Predicted Effect probably benign
Transcript: ENSMUST00000210816
Predicted Effect probably benign
Transcript: ENSMUST00000210830
Predicted Effect probably benign
Transcript: ENSMUST00000211146
Predicted Effect probably damaging
Transcript: ENSMUST00000211537
AA Change: R303T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit frequent exencephaly associated with neonatal lethality, rib cage abnormalities, and a low frequency of homeotic transformations of cervical segments but no presphenoid bone or cranial nerve defects; non-exencephalic survivors are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Deaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Deaf1 APN 7 141324181 critical splice acceptor site probably null
IGL02393:Deaf1 APN 7 141313333 missense possibly damaging 0.95
IGL03108:Deaf1 APN 7 141322961 missense probably damaging 1.00
IGL03344:Deaf1 APN 7 141297548 missense probably benign 0.08
Qball UTSW 7 141322468 missense probably damaging 1.00
R1543:Deaf1 UTSW 7 141324147 missense possibly damaging 0.65
R2849:Deaf1 UTSW 7 141314454 makesense probably null
R4600:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4611:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4649:Deaf1 UTSW 7 141297573 missense possibly damaging 0.59
R4953:Deaf1 UTSW 7 141322468 missense probably damaging 1.00
R6349:Deaf1 UTSW 7 141322950 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGACTCAGGCCAAATCTGACTGTG -3'
(R):5'- AAAGCTCCAGATGTCGAGGCTGTG -3'

Sequencing Primer
(F):5'- AATCTGACTGTGGGGCCAG -3'
(R):5'- TGGCAGCAGTGCTCTTC -3'
Posted On2014-05-14