Incidental Mutation 'R1702:Muc6'
ID189809
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Namemucin 6, gastric
Synonyms
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141633456-141655319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141650487 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 322 (N322K)
Ref Sequence ENSEMBL: ENSMUSP00000140388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062451
AA Change: N363K

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: N363K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000189314
AA Change: N322K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191
AA Change: N322K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190907
AA Change: N363K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: N363K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141638584 missense probably benign 0.06
IGL00466:Muc6 APN 7 141645902 missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141638890 missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141648066 nonsense probably null
IGL01021:Muc6 APN 7 141637162 missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141648454 missense probably damaging 1.00
IGL01294:Muc6 APN 7 141646659 missense probably damaging 1.00
IGL01449:Muc6 APN 7 141638614 missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141651307 missense probably damaging 1.00
IGL01539:Muc6 APN 7 141650041 missense probably benign 0.07
IGL01541:Muc6 APN 7 141649804 nonsense probably null
IGL01810:Muc6 APN 7 141651062 missense probably damaging 0.97
IGL01941:Muc6 APN 7 141638584 missense probably benign 0.06
IGL01954:Muc6 APN 7 141638584 missense probably benign 0.06
IGL02096:Muc6 APN 7 141639850 intron probably benign
IGL02192:Muc6 APN 7 141637804 missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141649624 missense probably damaging 1.00
IGL02234:Muc6 APN 7 141640575 missense probably benign 0.09
IGL02302:Muc6 APN 7 141641496 missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141640459 missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141636940 missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141649578 splice site probably benign
IGL02851:Muc6 APN 7 141648361 missense probably damaging 1.00
IGL03026:Muc6 APN 7 141640147 intron probably benign
IGL03070:Muc6 APN 7 141644567 splice site probably benign
IGL03108:Muc6 APN 7 141637489 missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141652059 missense probably damaging 1.00
IGL03366:Muc6 APN 7 141648082 missense probably damaging 1.00
F5770:Muc6 UTSW 7 141647613 missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R0153:Muc6 UTSW 7 141634116 missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141639559 intron probably benign
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141636955 missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141652283 missense probably benign 0.01
R0499:Muc6 UTSW 7 141640468 missense probably benign
R0503:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141638584 missense probably benign 0.06
R0792:Muc6 UTSW 7 141639559 intron probably benign
R0880:Muc6 UTSW 7 141637357 missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141644233 missense probably damaging 0.99
R1174:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1175:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1189:Muc6 UTSW 7 141645855 missense probably damaging 1.00
R1259:Muc6 UTSW 7 141640197 intron probably benign
R1293:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R1295:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1296:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1471:Muc6 UTSW 7 141647909 missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1548:Muc6 UTSW 7 141652103 splice site probably benign
R1548:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1576:Muc6 UTSW 7 141634524 missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141647998 missense probably damaging 1.00
R1792:Muc6 UTSW 7 141634458 missense probably benign 0.41
R1924:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141637098 missense probably damaging 0.99
R1964:Muc6 UTSW 7 141640062 nonsense probably null
R1964:Muc6 UTSW 7 141640063 intron probably benign
R1975:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R2031:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141634078 missense probably benign 0.23
R2201:Muc6 UTSW 7 141649810 missense probably damaging 1.00
R2218:Muc6 UTSW 7 141646960 missense probably benign 0.41
R2245:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141637924 missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141637531 missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141640384 missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141637038 missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141648681 splice site probably benign
R3872:Muc6 UTSW 7 141640600 missense probably benign
R4029:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141648655 missense probably damaging 1.00
R4126:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141637663 missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141640089 intron probably benign
R4509:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141644222 missense probably benign 0.03
R4594:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141639790 intron probably benign
R4678:Muc6 UTSW 7 141644287 missense probably benign 0.09
R4737:Muc6 UTSW 7 141640159 intron probably benign
R4737:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4981:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141639559 intron probably benign
R5012:Muc6 UTSW 7 141636657 missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141640528 missense probably benign
R5027:Muc6 UTSW 7 141636436 missense probably benign 0.01
R5058:Muc6 UTSW 7 141644224 missense probably benign 0.01
R5069:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5126:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5168:Muc6 UTSW 7 141639559 intron probably benign
R5179:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141651110 missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141637923 missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141648813 missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141636535 missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141649585 critical splice donor site probably null
R5800:Muc6 UTSW 7 141640423 splice site probably benign
R5808:Muc6 UTSW 7 141640093 intron probably benign
R5865:Muc6 UTSW 7 141650504 missense probably damaging 0.97
R5919:Muc6 UTSW 7 141641570 missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141648374 missense probably damaging 1.00
R6126:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141640525 missense probably benign
R6236:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141648821 missense probably damaging 1.00
R6254:Muc6 UTSW 7 141651115 missense probably benign 0.09
R6418:Muc6 UTSW 7 141639610 intron probably benign
R6609:Muc6 UTSW 7 141640433 splice site probably benign
R6610:Muc6 UTSW 7 141640433 splice site probably benign
R6611:Muc6 UTSW 7 141640433 splice site probably benign
R6623:Muc6 UTSW 7 141639559 intron probably benign
R6626:Muc6 UTSW 7 141639559 intron probably benign
R6817:Muc6 UTSW 7 141651061 missense probably damaging 0.99
R6923:Muc6 UTSW 7 141637540 missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141639979 intron probably benign
R7001:Muc6 UTSW 7 141637407 missense probably damaging 0.99
R7046:Muc6 UTSW 7 141640189 intron probably benign
R7097:Muc6 UTSW 7 141634450 frame shift probably null
R7099:Muc6 UTSW 7 141634450 frame shift probably null
R7101:Muc6 UTSW 7 141634450 frame shift probably null
R7107:Muc6 UTSW 7 141634450 frame shift probably null
R7108:Muc6 UTSW 7 141634450 frame shift probably null
R7112:Muc6 UTSW 7 141649277 missense not run
R7121:Muc6 UTSW 7 141634450 frame shift probably null
V7581:Muc6 UTSW 7 141647613 missense probably benign 0.11
V7583:Muc6 UTSW 7 141647613 missense probably benign 0.11
X0026:Muc6 UTSW 7 141651699 missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGATGGATAGGTAACACCTGGAC -3'
(R):5'- ACCAAAGGAGACACTGATGTTGAGC -3'

Sequencing Primer
(F):5'- CTGGACCTGGGACTCAGATATAG -3'
(R):5'- AGCTGTGCCACACTATCTGAG -3'
Posted On2014-05-14