Incidental Mutation 'R1702:Slc25a39'
ID189820
Institutional Source Beutler Lab
Gene Symbol Slc25a39
Ensembl Gene ENSMUSG00000018677
Gene Namesolute carrier family 25, member 39
SynonymsD11Ertd333e, 3010027G13Rik
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102402985-102407946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102406626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000114481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000142097] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104]
Predicted Effect probably benign
Transcript: ENSMUST00000006750
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
AA Change: D5G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
AA Change: D5G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107102
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107103
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107105
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
AA Change: D5G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
AA Change: D5G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect possibly damaging
Transcript: ENSMUST00000134669
AA Change: D5G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect probably benign
Transcript: ENSMUST00000142097
AA Change: D5G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect possibly damaging
Transcript: ENSMUST00000149777
AA Change: D5G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000154001
AA Change: D5G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155104
AA Change: D5G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC25 transporter or mitochondrial carrier family of proteins. Members of this family are encoded by the nuclear genome while their protein products are usually embedded in the inner mitochondrial membrane and exhibit wide-ranging substrate specificity. Although the encoded protein is currently considered an orphan transporter, this protein is related to other carriers known to transport amino acids. This protein may play a role in iron homeostasis. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Slc25a39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Slc25a39 APN 11 102404900 missense probably damaging 1.00
IGL01601:Slc25a39 APN 11 102405718 missense probably damaging 1.00
IGL02734:Slc25a39 APN 11 102404523 missense probably benign 0.03
IGL03382:Slc25a39 APN 11 102406204 critical splice donor site probably null
R0218:Slc25a39 UTSW 11 102406230 missense probably benign 0.00
R0359:Slc25a39 UTSW 11 102406569 missense possibly damaging 0.88
R0939:Slc25a39 UTSW 11 102405051 missense probably damaging 1.00
R2047:Slc25a39 UTSW 11 102405831 splice site probably benign
R2367:Slc25a39 UTSW 11 102403651 missense possibly damaging 0.52
R4018:Slc25a39 UTSW 11 102405024 missense probably damaging 1.00
R4755:Slc25a39 UTSW 11 102406666 start gained probably benign
R4878:Slc25a39 UTSW 11 102403675 missense probably benign 0.06
R5629:Slc25a39 UTSW 11 102404893 nonsense probably null
R5704:Slc25a39 UTSW 11 102403394 unclassified probably benign
R6092:Slc25a39 UTSW 11 102404893 nonsense probably null
R6502:Slc25a39 UTSW 11 102404460 missense probably damaging 0.99
R6955:Slc25a39 UTSW 11 102403518 missense probably benign 0.00
R6980:Slc25a39 UTSW 11 102405775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTCGCCTTGATCTGGTACTCAC -3'
(R):5'- GAGGCAAACTCTGGATGAGACCTG -3'

Sequencing Primer
(F):5'- GAAGGTTCCTTCAGGACACC -3'
(R):5'- CTCTGGATGAGACCTGAGTGC -3'
Posted On2014-05-14