Incidental Mutation 'R1702:Sec24c'
ID189828
Institutional Source Beutler Lab
Gene Symbol Sec24c
Ensembl Gene ENSMUSG00000039367
Gene NameSec24 related gene family, member C (S. cerevisiae)
Synonyms2610204K03Rik
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20674308-20694852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20686573 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 226 (G226V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224492] [ENSMUST00000224791] [ENSMUST00000224876] [ENSMUST00000225108]
Predicted Effect probably damaging
Transcript: ENSMUST00000048657
AA Change: G353V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367
AA Change: G353V

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183515
Predicted Effect probably damaging
Transcript: ENSMUST00000223751
AA Change: G277V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000224492
Predicted Effect probably benign
Transcript: ENSMUST00000224791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224793
Predicted Effect probably benign
Transcript: ENSMUST00000224876
Predicted Effect probably null
Transcript: ENSMUST00000225108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225566
Predicted Effect probably null
Transcript: ENSMUST00000228545
AA Change: G226V
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Sec24c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sec24c APN 14 20693203 missense probably benign 0.03
IGL00574:Sec24c APN 14 20692395 missense probably damaging 0.99
IGL01514:Sec24c APN 14 20682771 missense possibly damaging 0.78
IGL01924:Sec24c APN 14 20689689 missense probably damaging 0.96
IGL02094:Sec24c APN 14 20688402 missense probably damaging 1.00
IGL02677:Sec24c APN 14 20689642 missense probably damaging 0.98
IGL02871:Sec24c APN 14 20692882 missense probably benign
kahuna UTSW 14 20690773 missense probably damaging 0.99
R0010:Sec24c UTSW 14 20689261 unclassified probably benign
R0335:Sec24c UTSW 14 20688715 intron probably null
R0487:Sec24c UTSW 14 20683399 missense probably benign 0.01
R0609:Sec24c UTSW 14 20686948 missense probably damaging 1.00
R0626:Sec24c UTSW 14 20688437 missense probably damaging 1.00
R0734:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R0854:Sec24c UTSW 14 20689340 missense probably damaging 1.00
R1036:Sec24c UTSW 14 20692897 missense probably benign 0.14
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1765:Sec24c UTSW 14 20688854 unclassified probably benign
R1913:Sec24c UTSW 14 20689111 missense probably benign 0.06
R1920:Sec24c UTSW 14 20686887 missense probably damaging 0.99
R2084:Sec24c UTSW 14 20691279 missense probably benign 0.00
R3778:Sec24c UTSW 14 20683307 missense possibly damaging 0.63
R4383:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4385:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4659:Sec24c UTSW 14 20683144 missense probably damaging 0.99
R4798:Sec24c UTSW 14 20693712 missense probably damaging 1.00
R4872:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R5210:Sec24c UTSW 14 20691804 missense probably damaging 1.00
R5345:Sec24c UTSW 14 20693220 missense probably benign 0.00
R5610:Sec24c UTSW 14 20691825 missense probably damaging 1.00
R5614:Sec24c UTSW 14 20682738 missense possibly damaging 0.92
R5646:Sec24c UTSW 14 20679573 missense probably benign 0.01
R6460:Sec24c UTSW 14 20690800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTACCTGTTCGTGTGCTACC -3'
(R):5'- ACAGAAGCCTTGTTGATACCAGCTC -3'

Sequencing Primer
(F):5'- CGTGTGCTACCTGCTGTG -3'
(R):5'- CAGTAGCTTTTAGACCCTGAAGGAC -3'
Posted On2014-05-14