Incidental Mutation 'R1702:Shank3'
ID189835
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R1702 (G1)
Quality Score101
Status Not validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89499896 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 14 (G14C)
Ref Sequence ENSEMBL: ENSMUSP00000048062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309]
PDB Structure
Tetrahydroquinoline carboxylates are potent inhibitors of the Shank PDZ domain, a putative target in autism disorders [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000039074
AA Change: G14C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: G14C

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066545
SMART Domains Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
ANK 109 138 1.54e-1 SMART
ANK 142 172 3.36e2 SMART
ANK 176 205 2.47e0 SMART
ANK 209 238 3.71e-4 SMART
ANK 242 272 5.03e2 SMART
low complexity region 361 389 N/A INTRINSIC
SH3 400 455 1.28e-14 SMART
PDZ 506 591 3.95e-13 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109309
AA Change: G89C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: G89C

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135214
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gabrg3 T C 7: 56,985,100 T112A probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCGATGCAGCTAAACCGT -3'
(R):5'- ATTGAGGGCGCAGAGCACAC -3'

Sequencing Primer
(F):5'- TAAACCGTGCCGCCGTC -3'
(R):5'- AGAGCACACGCTGCTTG -3'
Posted On2014-05-14