Incidental Mutation 'R1703:Olfr1118'
ID189859
Institutional Source Beutler Lab
Gene Symbol Olfr1118
Ensembl Gene ENSMUSG00000083706
Gene Nameolfactory receptor 1118
SynonymsMOR264-22, Olfr1118-ps, GA_x6K02T2Q125-48795705-48796673
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87307581-87313621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87309410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000144143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090717] [ENSMUST00000121296] [ENSMUST00000216396]
Predicted Effect probably benign
Transcript: ENSMUST00000090717
AA Change: V207A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132837
Gene: ENSMUSG00000070855
AA Change: V207A

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.1e-53 PFAM
Pfam:7tm_1 32 281 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120328
Predicted Effect probably benign
Transcript: ENSMUST00000121296
AA Change: V207A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706
AA Change: V207A

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.2e-51 PFAM
Pfam:7tm_1 32 281 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216396
AA Change: V227A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sgca A T 11: 94,969,391 L307M probably damaging Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Olfr1118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1118 APN 2 87309581 missense possibly damaging 0.95
IGL01458:Olfr1118 APN 2 87309482 missense probably damaging 1.00
IGL02544:Olfr1118 APN 2 87309127 missense possibly damaging 0.91
IGL02748:Olfr1118 APN 2 87309665 missense probably damaging 1.00
IGL03077:Olfr1118 APN 2 87309712 makesense probably null
R0411:Olfr1118 UTSW 2 87309058 missense probably benign 0.07
R0525:Olfr1118 UTSW 2 87309349 missense probably benign 0.10
R1750:Olfr1118 UTSW 2 87308852 missense probably benign 0.02
R2005:Olfr1118 UTSW 2 87309448 missense probably benign 0.24
R2090:Olfr1118 UTSW 2 87309418 missense probably benign 0.02
R3846:Olfr1118 UTSW 2 87309182 missense probably benign 0.15
R4011:Olfr1118 UTSW 2 87309211 missense probably benign 0.03
R4077:Olfr1118 UTSW 2 87308864 unclassified probably null 0.42
R5132:Olfr1118 UTSW 2 87308938 missense probably damaging 1.00
R5368:Olfr1118 UTSW 2 87308782 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACATTTCTGTGTTTGCCTGTGCAAC -3'
(R):5'- GAAAAGAGATAGCAGCTTCCCCATTCC -3'

Sequencing Primer
(F):5'- TCCTGTACAAATTGGGCAGAC -3'
(R):5'- ATTCCTTCTGACTGACTTTGTTTGG -3'
Posted On2014-05-14