Incidental Mutation 'R1703:Sgca'
ID189906
Institutional Source Beutler Lab
Gene Symbol Sgca
Ensembl Gene ENSMUSG00000001508
Gene Namesarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms50DAG, adhalin, Asg
MMRRC Submission 039736-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R1703 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94962791-94976327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94969391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 307 (L307M)
Ref Sequence ENSEMBL: ENSMUSP00000130617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038928] [ENSMUST00000100551] [ENSMUST00000103162] [ENSMUST00000139855] [ENSMUST00000152042] [ENSMUST00000166320]
Predicted Effect probably benign
Transcript: ENSMUST00000038928
SMART Domains Protein: ENSMUSP00000039866
Gene: ENSMUSG00000038994

DomainStartEndE-ValueType
Pfam:Linker_histone 35 106 5.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100551
AA Change: L307M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098118
Gene: ENSMUSG00000001508
AA Change: L307M

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103162
AA Change: L307M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099451
Gene: ENSMUSG00000001508
AA Change: L307M

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139855
AA Change: L60M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117637
Gene: ENSMUSG00000001508
AA Change: L60M

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 1 140 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152042
SMART Domains Protein: ENSMUSP00000118455
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 6 100 5.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166320
AA Change: L307M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130617
Gene: ENSMUSG00000001508
AA Change: L307M

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes a member of the sarcoglycan alpha/epsilon family of transmembrane proteins. The encoded protein is part of the dystrophin-glycoprotein complex which links the extracellular matrix to the cytoskeleton in muscle fibers. Disruption of this gene results in progressive muscular dystrophy and is associated with the development of embryonal rhabdomysarcoma. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in muscle abnormalities, with decreased skeletal muscle force and stiffness and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,702 Y401* probably null Het
4932415M13Rik C A 17: 53,725,037 noncoding transcript Het
Acoxl T A 2: 127,978,772 S81R probably damaging Het
Adamtsl4 A G 3: 95,677,614 C915R probably damaging Het
Adgra3 C T 5: 50,006,775 M287I probably benign Het
Afg1l T G 10: 42,400,399 D250A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Amfr T C 8: 93,974,243 T530A probably benign Het
Ank2 C T 3: 126,929,766 V971M probably damaging Het
App A G 16: 84,965,768 S656P probably damaging Het
Arid5a T A 1: 36,319,575 probably null Het
Asic5 T A 3: 81,999,722 V60D possibly damaging Het
Atm G T 9: 53,500,700 H1019N probably benign Het
Btbd11 A G 10: 85,387,384 D19G unknown Het
Cep250 A G 2: 155,965,546 K277R probably benign Het
Chrna7 C T 7: 63,099,507 R409H probably damaging Het
Chrng A T 1: 87,210,906 N419I possibly damaging Het
Ciao1 T C 2: 127,245,819 S199G probably benign Het
Clstn2 A T 9: 97,458,237 M694K possibly damaging Het
Cpeb2 A G 5: 43,233,838 probably benign Het
Cyp2c69 T A 19: 39,876,366 I223F probably benign Het
Dennd1b A T 1: 139,169,754 probably null Het
Dnah17 A T 11: 118,026,749 L4162Q probably damaging Het
Dnm1 T C 2: 32,323,451 M506V probably benign Het
Ecsit A G 9: 22,074,811 V173A probably damaging Het
Fam13b T C 18: 34,451,439 probably null Het
Fgl2 T A 5: 21,372,732 W6R possibly damaging Het
Galnt9 G A 5: 110,619,172 R503H probably damaging Het
Gm884 C T 11: 103,540,874 V1372I probably benign Het
Gramd1a C T 7: 31,139,534 V247M possibly damaging Het
Grip2 A T 6: 91,777,398 I632N probably damaging Het
Hspg2 T C 4: 137,559,151 V3627A probably damaging Het
Ipo8 T C 6: 148,789,892 Y660C probably benign Het
Isg15 T C 4: 156,199,808 R88G possibly damaging Het
Itgb5 T A 16: 33,910,500 D388E probably benign Het
Jhy T C 9: 40,944,837 Y118C probably damaging Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kif21a A G 15: 90,949,047 probably null Het
Lama2 A T 10: 27,266,671 Y604N probably damaging Het
Lrp3 T G 7: 35,213,161 S34R possibly damaging Het
Lyn T C 4: 3,738,867 probably null Het
Mroh8 C T 2: 157,271,976 V132I probably benign Het
Mthfd1l T C 10: 4,148,093 F977L probably damaging Het
Nol8 C T 13: 49,667,457 T912M possibly damaging Het
Nrxn1 A T 17: 90,208,417 N169K probably damaging Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr1188 T A 2: 88,560,255 M262K possibly damaging Het
Oplah A G 15: 76,296,667 Y1279H probably benign Het
Pcsk5 T C 19: 17,752,094 N129S probably benign Het
Pcyt2 G T 11: 120,613,068 P185T probably benign Het
Pdlim2 A G 14: 70,174,335 probably null Het
Pgs1 T C 11: 118,014,728 probably benign Het
Qprt A G 7: 127,108,171 V251A probably benign Het
Rasal2 A C 1: 157,157,600 L834R probably damaging Het
Reg1 T C 6: 78,428,449 C161R probably damaging Het
Rp1 T A 1: 4,345,169 I1907F probably damaging Het
S1pr5 T C 9: 21,244,050 D360G possibly damaging Het
Sart3 C A 5: 113,752,219 V482F probably benign Het
Scarf2 A G 16: 17,802,849 E127G probably damaging Het
Serinc5 T C 13: 92,688,797 S245P probably damaging Het
Serpinc1 G T 1: 160,993,517 R57L probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc7a9 C A 7: 35,454,575 Q208K probably benign Het
Slfn10-ps C T 11: 83,030,043 noncoding transcript Het
Spam1 A T 6: 24,796,257 D69V probably damaging Het
Tanc1 A G 2: 59,843,021 E1490G probably benign Het
Tbc1d22a G T 15: 86,239,215 D150Y probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tlx1 A G 19: 45,156,004 D55G possibly damaging Het
Tram2 G T 1: 21,004,234 N241K probably damaging Het
Ttc23l T C 15: 10,523,658 Y325C probably damaging Het
Ubac2 T A 14: 121,905,170 S27T probably benign Het
Utrn G A 10: 12,727,729 probably benign Het
Vnn3 A T 10: 23,865,930 M378L probably benign Het
Vps18 T A 2: 119,289,057 D6E probably benign Het
Xkr5 T A 8: 18,939,118 I253F probably benign Het
Yeats4 A T 10: 117,215,723 C210S probably benign Het
Zdhhc20 A G 14: 57,839,088 probably null Het
Other mutations in Sgca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Sgca APN 11 94972287 missense probably damaging 1.00
IGL01479:Sgca APN 11 94963378 nonsense probably null
IGL02153:Sgca APN 11 94963284 missense probably damaging 1.00
IGL02713:Sgca APN 11 94971305 missense probably damaging 1.00
IGL02928:Sgca APN 11 94972303 missense probably damaging 1.00
IGL03185:Sgca APN 11 94970784 missense probably benign 0.00
R0602:Sgca UTSW 11 94963235 missense possibly damaging 0.94
R0834:Sgca UTSW 11 94970686 nonsense probably null
R1547:Sgca UTSW 11 94969433 missense probably damaging 1.00
R4110:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4112:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4796:Sgca UTSW 11 94970727 unclassified probably null
R5301:Sgca UTSW 11 94963331 missense probably damaging 1.00
R6301:Sgca UTSW 11 94972567 missense probably damaging 1.00
R6347:Sgca UTSW 11 94972028 missense probably damaging 1.00
R6510:Sgca UTSW 11 94963232 missense probably benign 0.36
R7110:Sgca UTSW 11 94963401 critical splice acceptor site probably null
R7121:Sgca UTSW 11 94969547 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCGATCTGGCTTTGCTCTATGATG -3'
(R):5'- AGCCCTGAACTCTATGCAGGTAGAC -3'

Sequencing Primer
(F):5'- TATGATGTCCCAAGAGTTCCCAAG -3'
(R):5'- CTGAACTCTATGCAGGTAGACAAGTC -3'
Posted On2014-05-14