Incidental Mutation 'R1704:Nos1ap'
ID189943
Institutional Source Beutler Lab
Gene Symbol Nos1ap
Ensembl Gene ENSMUSG00000038473
Gene Namenitric oxide synthase 1 (neuronal) adaptor protein
Synonyms6330408P19Rik
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170302668-170589861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 170338212 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 161 (E161Q)
Ref Sequence ENSEMBL: ENSMUSP00000125251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160456] [ENSMUST00000160466] [ENSMUST00000161485] [ENSMUST00000161966]
Predicted Effect probably damaging
Transcript: ENSMUST00000160456
AA Change: E161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125251
Gene: ENSMUSG00000038473
AA Change: E161Q

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 313 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160466
AA Change: E107Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125687
Gene: ENSMUSG00000038473
AA Change: E107Q

DomainStartEndE-ValueType
Pfam:PID 1 116 4e-25 PFAM
low complexity region 212 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160816
Predicted Effect probably damaging
Transcript: ENSMUST00000161485
AA Change: E112Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124169
Gene: ENSMUSG00000038473
AA Change: E112Q

DomainStartEndE-ValueType
Pfam:PID 1 121 3e-26 PFAM
low complexity region 213 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161966
AA Change: E161Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124240
Gene: ENSMUSG00000038473
AA Change: E161Q

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 285 N/A INTRINSIC
low complexity region 290 322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Nos1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Nos1ap APN 1 170514606 splice site probably benign
IGL01151:Nos1ap APN 1 170589276 missense probably damaging 1.00
IGL02056:Nos1ap APN 1 170318623 missense possibly damaging 0.93
IGL02712:Nos1ap APN 1 170329251 missense possibly damaging 0.93
IGL03177:Nos1ap APN 1 170390730 critical splice donor site probably null
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0621:Nos1ap UTSW 1 170318581 missense probably damaging 0.99
R1332:Nos1ap UTSW 1 170349432 missense probably damaging 1.00
R1523:Nos1ap UTSW 1 170338118 missense probably benign 0.03
R1660:Nos1ap UTSW 1 170514637 missense possibly damaging 0.89
R1764:Nos1ap UTSW 1 170318878 missense possibly damaging 0.83
R1905:Nos1ap UTSW 1 170318558 missense possibly damaging 0.70
R2056:Nos1ap UTSW 1 170327646 missense probably damaging 1.00
R2140:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R2141:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R3890:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3891:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3892:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R4109:Nos1ap UTSW 1 170318668 missense probably benign
R5305:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5306:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5412:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5414:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5444:Nos1ap UTSW 1 170375251 missense probably damaging 1.00
R5636:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5637:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5638:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5753:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5754:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5787:Nos1ap UTSW 1 170318572 missense probably benign 0.41
R7060:Nos1ap UTSW 1 170338125 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGTTACCATGATGTCGCCTTTGC -3'
(R):5'- TCTGGCTGCCTGGATTTCTGATCAC -3'

Sequencing Primer
(F):5'- cgtgcaggaagctgagg -3'
(R):5'- GGATTTCTGATCACCTTGCG -3'
Posted On2014-05-14