Incidental Mutation 'R1704:Scn10a'
ID189977
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119609394 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1803 (D1803G)
Ref Sequence ENSEMBL: ENSMUSP00000150830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably damaging
Transcript: ENSMUST00000084787
AA Change: D1803G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: D1803G

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213392
AA Change: D1802G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214408
AA Change: D1803G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCGATTTGTCTGGGAGCCCAC -3'
(R):5'- TCTATGAGACCTGGGAGAAGTTTGACC -3'

Sequencing Primer
(F):5'- GAATGTAACATAGCCTTCCCTGG -3'
(R):5'- GAAGTTTGACCCGGAGGC -3'
Posted On2014-05-14