Incidental Mutation 'R1704:Nf1'
ID189982
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 039737-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 79463301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
Predicted Effect probably null
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130979
Predicted Effect probably benign
Transcript: ENSMUST00000219057
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCCTGAGATTGCTTGAGGACAGC -3'
(R):5'- TGAAGACAGTCAGCATCCCCTAAGG -3'

Sequencing Primer
(F):5'- AGACATGATTGGGTCTCACC -3'
(R):5'- GGCCTTGAAATTAAGTTTCTTTCGC -3'
Posted On2014-05-14