Incidental Mutation 'R1705:R3hdm1'
ID189997
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission 039738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1705 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128235084 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 966 (L966Q)
Ref Sequence ENSEMBL: ENSMUSP00000043103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288]
Predicted Effect probably damaging
Transcript: ENSMUST00000036288
AA Change: L966Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: L966Q

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190288
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 90% (43/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apaf1 A G 10: 91,067,271 probably benign Het
C130060K24Rik A T 6: 65,456,306 H370L probably benign Het
C1ql2 A G 1: 120,342,542 T278A probably damaging Het
Card14 A G 11: 119,338,406 H714R possibly damaging Het
Catsperd T C 17: 56,633,521 F69S probably damaging Het
Cep250 A G 2: 155,963,786 E105G probably damaging Het
Coil A G 11: 88,974,136 Y63C probably damaging Het
Cox14 A G 15: 99,727,678 probably null Het
D230025D16Rik T C 8: 105,238,472 probably benign Het
Defa24 T C 8: 21,734,601 I22T probably damaging Het
F5 T C 1: 164,217,490 Y2116H possibly damaging Het
Faf1 C T 4: 109,677,002 probably benign Het
Hectd4 A G 5: 121,298,104 S1026G probably benign Het
Hgf A T 5: 16,615,802 H649L probably benign Het
Hmces T C 6: 87,933,301 V231A probably damaging Het
Kcnh4 A G 11: 100,741,772 V963A probably benign Het
Ltbp1 T C 17: 75,385,201 probably null Het
Meox2 G A 12: 37,167,494 probably benign Het
Mis18bp1 A C 12: 65,149,339 S550R probably benign Het
Nap1l4 A T 7: 143,541,760 M1K probably null Het
Nav1 G T 1: 135,584,599 T241N probably damaging Het
Nbeal2 A G 9: 110,625,196 W2694R probably damaging Het
Olfr11 C A 13: 21,639,161 D121Y probably damaging Het
Olfr1263 A T 2: 90,015,511 I194F possibly damaging Het
Olfr744 A T 14: 50,619,122 H300L probably benign Het
Pld1 G A 3: 28,071,277 probably null Het
Podn T C 4: 108,017,858 R164G probably benign Het
Rasef A T 4: 73,744,064 Y369* probably null Het
Ryr1 A T 7: 29,078,564 V2176E probably damaging Het
Sec14l2 A G 11: 4,103,980 L229P possibly damaging Het
Sec23a T C 12: 59,001,866 S157G possibly damaging Het
Slit2 T A 5: 48,189,472 W219R probably damaging Het
Smarcad1 G A 6: 65,056,416 E128K probably damaging Het
Stk31 A T 6: 49,423,384 N381I possibly damaging Het
Svop A G 5: 114,042,295 Y264H probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Ush2a T A 1: 188,874,869 I3987N probably damaging Het
Ush2a T A 1: 188,911,541 S4367T probably benign Het
Vdr A T 15: 97,867,171 V229D probably damaging Het
Ywhaz G T 15: 36,790,715 T88K possibly damaging Het
Zc3h10 A T 10: 128,544,803 C228* probably null Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTATTCACCTTTCGGACG -3'
(R):5'- ATTAACAGTTGGCTCCAGCACCTC -3'

Sequencing Primer
(F):5'- atgaatgaatgaatgaatgaatgcc -3'
(R):5'- AGCACCTCTGATATCTTCAGAAAG -3'
Posted On2014-05-14