Incidental Mutation 'R1705:Syt10'
ID190038
Institutional Source Beutler Lab
Gene Symbol Syt10
Ensembl Gene ENSMUSG00000063260
Gene Namesynaptotagmin X
Synonyms
MMRRC Submission 039738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1705 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89782393-89841860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89790776 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 456 (D456N)
Ref Sequence ENSEMBL: ENSMUSP00000029441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029441]
Predicted Effect probably damaging
Transcript: ENSMUST00000029441
AA Change: D456N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029441
Gene: ENSMUSG00000063260
AA Change: D456N

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
C2 247 350 1.22e-19 SMART
C2 379 493 7.73e-22 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 90% (43/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit minor circadian rhythm impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apaf1 A G 10: 91,067,271 probably benign Het
C130060K24Rik A T 6: 65,456,306 H370L probably benign Het
C1ql2 A G 1: 120,342,542 T278A probably damaging Het
Card14 A G 11: 119,338,406 H714R possibly damaging Het
Catsperd T C 17: 56,633,521 F69S probably damaging Het
Cep250 A G 2: 155,963,786 E105G probably damaging Het
Coil A G 11: 88,974,136 Y63C probably damaging Het
Cox14 A G 15: 99,727,678 probably null Het
D230025D16Rik T C 8: 105,238,472 probably benign Het
Defa24 T C 8: 21,734,601 I22T probably damaging Het
F5 T C 1: 164,217,490 Y2116H possibly damaging Het
Faf1 C T 4: 109,677,002 probably benign Het
Hectd4 A G 5: 121,298,104 S1026G probably benign Het
Hgf A T 5: 16,615,802 H649L probably benign Het
Hmces T C 6: 87,933,301 V231A probably damaging Het
Kcnh4 A G 11: 100,741,772 V963A probably benign Het
Ltbp1 T C 17: 75,385,201 probably null Het
Meox2 G A 12: 37,167,494 probably benign Het
Mis18bp1 A C 12: 65,149,339 S550R probably benign Het
Nap1l4 A T 7: 143,541,760 M1K probably null Het
Nav1 G T 1: 135,584,599 T241N probably damaging Het
Nbeal2 A G 9: 110,625,196 W2694R probably damaging Het
Olfr11 C A 13: 21,639,161 D121Y probably damaging Het
Olfr1263 A T 2: 90,015,511 I194F possibly damaging Het
Olfr744 A T 14: 50,619,122 H300L probably benign Het
Pld1 G A 3: 28,071,277 probably null Het
Podn T C 4: 108,017,858 R164G probably benign Het
R3hdm1 T A 1: 128,235,084 L966Q probably damaging Het
Rasef A T 4: 73,744,064 Y369* probably null Het
Ryr1 A T 7: 29,078,564 V2176E probably damaging Het
Sec14l2 A G 11: 4,103,980 L229P possibly damaging Het
Sec23a T C 12: 59,001,866 S157G possibly damaging Het
Slit2 T A 5: 48,189,472 W219R probably damaging Het
Smarcad1 G A 6: 65,056,416 E128K probably damaging Het
Stk31 A T 6: 49,423,384 N381I possibly damaging Het
Svop A G 5: 114,042,295 Y264H probably damaging Het
Ush2a T A 1: 188,874,869 I3987N probably damaging Het
Ush2a T A 1: 188,911,541 S4367T probably benign Het
Vdr A T 15: 97,867,171 V229D probably damaging Het
Ywhaz G T 15: 36,790,715 T88K possibly damaging Het
Zc3h10 A T 10: 128,544,803 C228* probably null Het
Other mutations in Syt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Syt10 APN 15 89814079 missense probably damaging 1.00
IGL02976:Syt10 APN 15 89814479 missense probably benign 0.26
R0200:Syt10 UTSW 15 89826941 missense probably benign 0.01
R0306:Syt10 UTSW 15 89826988 missense probably benign 0.02
R0580:Syt10 UTSW 15 89827176 missense probably benign 0.15
R0608:Syt10 UTSW 15 89826941 missense probably benign 0.01
R1706:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1921:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1922:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2072:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2074:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2119:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2120:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2121:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R3812:Syt10 UTSW 15 89790797 missense probably benign
R4029:Syt10 UTSW 15 89814538 missense probably benign
R4270:Syt10 UTSW 15 89790892 missense probably benign 0.39
R4536:Syt10 UTSW 15 89782622 missense probably damaging 0.99
R5333:Syt10 UTSW 15 89841729 missense probably benign 0.00
R6042:Syt10 UTSW 15 89841621 missense probably benign 0.13
R6104:Syt10 UTSW 15 89826864 missense probably benign 0.02
R6445:Syt10 UTSW 15 89814268 missense probably damaging 1.00
R6470:Syt10 UTSW 15 89792601 missense probably damaging 1.00
R6472:Syt10 UTSW 15 89814558 missense probably benign
R6679:Syt10 UTSW 15 89814371 missense probably damaging 1.00
R7048:Syt10 UTSW 15 89790805 missense probably damaging 1.00
R7128:Syt10 UTSW 15 89814111 missense not run
X0057:Syt10 UTSW 15 89826928 missense probably damaging 1.00
Z1088:Syt10 UTSW 15 89841639 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAATCCCATAGACCTGCTGCACC -3'
(R):5'- CAAAGTGTCTCTGATGTGTGAGGGC -3'

Sequencing Primer
(F):5'- GTGTGGTATCCCCTCTAGTAAAGC -3'
(R):5'- CTGATGTGTGAGGGCCGAAG -3'
Posted On2014-05-14