Incidental Mutation 'R1707:Nf1'
ID190171
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 039740-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1707 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79535604 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1594 (F1594I)
Ref Sequence ENSEMBL: ENSMUSP00000103886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000170799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071325
AA Change: F1615I

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: F1615I

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108251
AA Change: F1594I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: F1594I

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Predicted Effect probably benign
Transcript: ENSMUST00000170799
SMART Domains Protein: ENSMUSP00000125936
Gene: ENSMUSG00000078771

DomainStartEndE-ValueType
Pfam:EVI2A 1 223 6.3e-107 PFAM
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplp2 A T 9: 31,150,919 H692Q probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dhx57 A T 17: 80,275,226 S317T probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Intu T A 3: 40,540,924 S21T probably benign Het
Intu C A 3: 40,683,501 D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nasp T A 4: 116,618,936 Q51L probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Prr29 T C 11: 106,376,683 V124A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGCCTCAGCTTCTGAGCATC -3'
(R):5'- TGCAGAGACGTTGTCATAGGCAAAG -3'

Sequencing Primer
(F):5'- tggtagggagcgagggg -3'
(R):5'- TTGTCATAGGCAAAGCCAGG -3'
Posted On2014-05-14