Incidental Mutation 'R1710:Fmo3'
ID190390
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162967787 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 160 (F160L)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028010
AA Change: F160L

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: F160L

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142759
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1209:Fmo3 UTSW 1 162964028 missense probably benign 0.00
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1612:Fmo3 UTSW 1 162967885 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R2519:Fmo3 UTSW 1 162958305 missense probably damaging 1.00
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4846:Fmo3 UTSW 1 162954311 missense possibly damaging 0.94
R4892:Fmo3 UTSW 1 162968731 missense probably benign 0.00
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R7050:Fmo3 UTSW 1 162963904 missense probably damaging 0.98
R7088:Fmo3 UTSW 1 162968865 missense not run
Predicted Primers PCR Primer
(F):5'- AGAACAAGCTTTGCTGTTGAGTCTCTC -3'
(R):5'- CTGCATTCCTTAGACACCTGTAACCAG -3'

Sequencing Primer
(F):5'- TGATGCAACTGgtgtgtgtg -3'
(R):5'- ACCACTGAAAAGCACGGT -3'
Posted On2014-05-14