Incidental Mutation 'R1710:Etv1'
ID190474
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Nameets variant 1
SynonymsEtsrp81, ER81
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location38779380-38870484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38852262 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 264 (F264S)
Ref Sequence ENSEMBL: ENSMUSP00000125692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]
Predicted Effect probably benign
Transcript: ENSMUST00000095767
AA Change: F282S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: F282S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159334
AA Change: F242S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: F242S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160244
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160701
AA Change: F179S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: F179S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160856
AA Change: F264S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: F264S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161591
Predicted Effect probably benign
Transcript: ENSMUST00000161980
AA Change: F224S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: F224S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162563
AA Change: F282S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: F282S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162730
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R2094:Etv1 UTSW 12 38835116 missense probably null 1.00
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4353:Etv1 UTSW 12 38857106 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 unclassified probably null
R5024:Etv1 UTSW 12 38854234 splice site probably null
R5253:Etv1 UTSW 12 38852249 missense possibly damaging 0.50
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTGGAGGCCCCACTGAAAATG -3'
(R):5'- TGCTTATGTCACCTTGCTGGGGAC -3'

Sequencing Primer
(F):5'- ATGTTTTCCACATTCTGACAGAC -3'
(R):5'- TGGTCAAGCACTCTGCTG -3'
Posted On2014-05-14