Incidental Mutation 'R1711:Osbpl9'
ID190535
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
MMRRC Submission 039744-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R1711 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109066218 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 495 (C495S)
Ref Sequence ENSEMBL: ENSMUSP00000124742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000065977] [ENSMUST00000084366] [ENSMUST00000102736] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably benign
Transcript: ENSMUST00000030288
AA Change: C512S

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: C512S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065977
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084366
AA Change: C415S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: C415S

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102736
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159198
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160271
AA Change: C402S

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: C402S

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160774
AA Change: C495S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: C495S

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161363
AA Change: C432S

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: C432S

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162787
AA Change: C499S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: C499S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194478
AA Change: C522S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: C522S

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Cacna1d T C 14: 30,066,056 K1619R probably damaging Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P possibly damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Itga9 T C 9: 118,698,461 V560A probably benign Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Olfr971 A G 9: 39,840,285 M284V probably benign Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pik3c2a A T 7: 116,417,927 Y198* probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ptprq T A 10: 107,534,699 R2044* probably null Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R6911:Osbpl9 UTSW 4 109156373 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTCCATAGCCATTGGGGAAC -3'
(R):5'- AGAACAGGACACGTCTTAAACCTGC -3'

Sequencing Primer
(F):5'- GGTGATATAGTTTATACCCCACCCAG -3'
(R):5'- TGCGGGAGTTGCCATAGC -3'
Posted On2014-05-14