Incidental Mutation 'R1711:Ptprq'
ID190594
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 039744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R1711 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107534699 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 2044 (R2044*)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably null
Transcript: ENSMUST00000050702
AA Change: R2044*
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: R2044*

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Cacna1d T C 14: 30,066,056 K1619R probably damaging Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P possibly damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Itga9 T C 9: 118,698,461 V560A probably benign Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Olfr971 A G 9: 39,840,285 M284V probably benign Het
Osbpl9 A T 4: 109,066,218 C495S probably damaging Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pik3c2a A T 7: 116,417,927 Y198* probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCTGTCTATCCCCGTCTCTGAA -3'
(R):5'- TGTTATCAGCTTTGTTATGTTTTCCAGCATTT -3'

Sequencing Primer
(F):5'- ATAATATGTGCCTCAGGTTGCTC -3'
(R):5'- GAATGTGGCACATAGCATTTGTAG -3'
Posted On2014-05-14