Incidental Mutation 'R1711:Cacna1d'
ID190611
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 039744-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R1711 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30066056 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1619 (K1619R)
Ref Sequence ENSEMBL: ENSMUSP00000153293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably benign
Transcript: ENSMUST00000112249
AA Change: K1619R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: K1619R

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112250
AA Change: K1641R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: K1641R

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223803
AA Change: K1619R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000224198
AA Change: K1654R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: K1619R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,269,920 T741I possibly damaging Het
Acot3 A T 12: 84,053,573 Q41L probably damaging Het
Actl7b G A 4: 56,740,165 Q398* probably null Het
Adgrb2 C A 4: 129,992,624 Q186K probably damaging Het
Akr1a1 A G 4: 116,637,974 probably null Het
Ap3s2 A T 7: 79,880,490 F192L probably damaging Het
Apobr T G 7: 126,584,979 probably null Het
Arhgap5 A G 12: 52,519,345 N1033S probably damaging Het
Arid3c G T 4: 41,725,947 R219S probably damaging Het
Bves C T 10: 45,347,865 T207M probably damaging Het
C330027C09Rik A C 16: 49,017,486 I850L probably benign Het
Caps2 A T 10: 112,190,978 D223V possibly damaging Het
Cd163l1 G T 7: 140,220,609 C101F probably damaging Het
Cd3g A C 9: 44,974,342 L35R probably damaging Het
Cdh23 A T 10: 60,523,536 V261E probably benign Het
Cfap54 T G 10: 93,011,020 T1028P possibly damaging Het
Ch25h C A 19: 34,474,286 V281L probably benign Het
Clu G T 14: 65,980,905 V405L possibly damaging Het
Col6a3 A T 1: 90,830,213 H6Q probably damaging Het
Cps1 G A 1: 67,168,374 probably null Het
Ctr9 T C 7: 111,055,663 S1134P unknown Het
Cts7 C T 13: 61,352,810 G308S probably damaging Het
Cyp2c39 C A 19: 39,566,891 T385K probably damaging Het
Dennd5a A T 7: 109,918,712 D596E probably benign Het
Disc1 T A 8: 125,124,610 I413K probably benign Het
Dll3 C T 7: 28,294,497 G505D probably damaging Het
Dnah3 A G 7: 120,078,571 W377R probably damaging Het
Dopey2 A G 16: 93,799,926 D1792G probably damaging Het
Dpep3 T A 8: 105,973,693 R460S probably benign Het
Ebf4 A G 2: 130,358,831 N302S probably damaging Het
Egflam T C 15: 7,289,915 E194G possibly damaging Het
Ep400 A T 5: 110,693,308 probably benign Het
Ercc6 T C 14: 32,526,176 M228T probably damaging Het
Fbxo9 T C 9: 78,087,247 T264A probably damaging Het
Fcrl5 C A 3: 87,457,414 P486T possibly damaging Het
Fyb T C 15: 6,580,479 F178L probably damaging Het
Gaa T A 11: 119,280,460 I646N probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13124 A T 4: 144,555,406 I272K probably damaging Het
Gm5431 A T 11: 48,895,026 V174E possibly damaging Het
Gnpat T G 8: 124,886,952 probably null Het
Gucy1a2 G T 9: 3,759,622 R476I probably benign Het
Hars A G 18: 36,771,103 L241P probably damaging Het
Haus5 G A 7: 30,657,903 Q399* probably null Het
Hephl1 T C 9: 15,059,246 E984G probably damaging Het
Hmces C T 6: 87,921,592 Q132* probably null Het
Hsp90b1 G T 10: 86,694,525 T490K probably damaging Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Ipo13 G T 4: 117,904,522 H465Q probably benign Het
Isca2 C A 12: 84,773,619 T31K probably damaging Het
Itga9 T C 9: 118,698,461 V560A probably benign Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Kcnj5 A G 9: 32,322,569 I150T probably damaging Het
Kmt2a A G 9: 44,841,621 I1419T unknown Het
Lix1 T C 17: 17,446,058 F160L possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Map4k1 A T 7: 28,989,352 Q276L possibly damaging Het
Mmp9 G A 2: 164,949,422 G171S probably damaging Het
Mvp C A 7: 126,995,735 probably null Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Nebl T A 2: 17,388,754 T603S probably damaging Het
Nudt15 T C 14: 73,523,336 D105G probably benign Het
Olfr1369-ps1 G A 13: 21,116,306 V205I probably benign Het
Olfr527 A C 7: 140,335,999 T46P possibly damaging Het
Olfr556 G T 7: 102,670,162 V81L probably damaging Het
Olfr65 T A 7: 103,906,699 W87R probably damaging Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Olfr971 A G 9: 39,840,285 M284V probably benign Het
Osbpl9 A T 4: 109,066,218 C495S probably damaging Het
Pamr1 A G 2: 102,640,852 T507A probably benign Het
Pcdhb9 T A 18: 37,403,327 C791* probably null Het
Pcgf6 T C 19: 47,050,518 E101G probably damaging Het
Pdgfrl A T 8: 40,985,794 I256F probably benign Het
Pdzd7 T C 19: 45,045,511 R45G possibly damaging Het
Pecr C T 1: 72,277,409 V46I possibly damaging Het
Pgr A G 9: 8,922,714 probably null Het
Pik3c2a A T 7: 116,417,927 Y198* probably null Het
Pp2d1 T A 17: 53,515,310 M243L possibly damaging Het
Ppp1r1a T A 15: 103,533,492 I50L possibly damaging Het
Proc T C 18: 32,127,406 D222G probably benign Het
Ptprq T A 10: 107,534,699 R2044* probably null Het
Ranbp2 T C 10: 58,460,519 V326A probably benign Het
Reep6 T A 10: 80,333,981 F122I possibly damaging Het
Rubcn C A 16: 32,843,101 R388S probably damaging Het
Rusc1 A G 3: 89,089,293 L62P probably damaging Het
Satb2 T C 1: 56,850,289 N423S probably damaging Het
Serpinb9d A G 13: 33,200,748 K236R probably benign Het
Slc4a7 A G 14: 14,765,709 R680G probably benign Het
Slitrk1 T A 14: 108,913,096 Y61F probably benign Het
Son A G 16: 91,660,226 probably benign Het
Sparc T A 11: 55,395,776 probably null Het
Spon2 A G 5: 33,216,385 F194S probably damaging Het
Spta1 A G 1: 174,241,042 E2136G probably damaging Het
Stat4 T C 1: 52,106,925 S746P probably damaging Het
Stk31 T A 6: 49,469,304 S958R probably benign Het
Stom T A 2: 35,315,917 I267F probably damaging Het
Stx12 A T 4: 132,858,477 D197E probably damaging Het
Taok3 A T 5: 117,255,926 N588I possibly damaging Het
Tgs1 A G 4: 3,598,658 D657G probably damaging Het
Trim6 A G 7: 104,232,837 T432A probably damaging Het
Trim72 C G 7: 128,004,585 C34W probably damaging Het
Trpc4ap A T 2: 155,657,744 I286N probably benign Het
Ttn A G 2: 76,863,561 V321A possibly damaging Het
Utp4 T A 8: 106,918,720 I583N probably damaging Het
Wdfy2 G T 14: 62,944,097 M225I probably benign Het
Wfdc1 A G 8: 119,681,037 T134A probably benign Het
Wnt9b A G 11: 103,732,128 S150P probably damaging Het
Zbtb46 A T 2: 181,411,684 F412I probably damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp11 A T 5: 129,656,673 Y575N probably benign Het
Zfp687 T C 3: 95,011,889 M191V probably benign Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTACCTTGCGACCCGGAAATG -3'
(R):5'- GTGTTATAGGCTGACAGCCCAGTG -3'

Sequencing Primer
(F):5'- ATCCTTGTGGCACTGCTCAA -3'
(R):5'- AGCCCAGTGCCCTTTGTG -3'
Posted On2014-05-14