Incidental Mutation 'R1712:Mtbp'
ID190709
Institutional Source Beutler Lab
Gene Symbol Mtbp
Ensembl Gene ENSMUSG00000022369
Gene NameMdm2, transformed 3T3 cell double minute p53 binding protein
SynonymsMDM2BP
MMRRC Submission 039745-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1712 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location55557408-55626423 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to T at 55571294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022998] [ENSMUST00000170046]
Predicted Effect probably null
Transcript: ENSMUST00000022998
SMART Domains Protein: ENSMUSP00000022998
Gene: ENSMUSG00000022369

DomainStartEndE-ValueType
Pfam:MTBP_N 1 270 1.2e-116 PFAM
Pfam:MTBP_mid 287 626 1.4e-161 PFAM
Pfam:MTBP_C 630 884 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169517
Predicted Effect probably null
Transcript: ENSMUST00000170046
SMART Domains Protein: ENSMUSP00000129396
Gene: ENSMUSG00000022369

DomainStartEndE-ValueType
Pfam:MTBP_N 1 276 3.4e-145 PFAM
Pfam:MTBP_mid 286 626 3.1e-171 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality; interestingly, heterozygous mice are not tumor prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,848,103 E12D probably damaging Het
Ahnak2 C A 12: 112,785,378 R283L probably benign Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
C1galt1 A G 6: 7,871,217 N351S probably benign Het
Ccdc162 T C 10: 41,539,431 R2179G probably benign Het
Ccdc88c G A 12: 100,939,025 T1108M probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cdc40 T C 10: 40,841,376 K440E probably damaging Het
Cenpe G A 3: 135,265,933 V2262I probably damaging Het
Cep290 A G 10: 100,554,499 K2035E probably benign Het
Cks1brt G T 8: 85,171,543 L8F probably benign Het
Col17a1 T C 19: 47,649,003 probably benign Het
Coro6 A T 11: 77,469,467 N421I probably benign Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Csrnp3 G T 2: 66,002,482 A110S probably damaging Het
Cyp2d10 G T 15: 82,403,039 T461K probably damaging Het
Dmxl2 A G 9: 54,401,485 V1994A probably benign Het
Dnah11 T A 12: 118,196,644 N117I probably benign Het
Dnajc3 A G 14: 118,957,895 Y74C probably damaging Het
Fam13c T A 10: 70,554,573 F555I possibly damaging Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Fbrsl1 T C 5: 110,447,996 T58A probably benign Het
Gjc1 A G 11: 102,800,880 I99T possibly damaging Het
Glce T C 9: 62,070,575 N9S probably damaging Het
Gosr1 T C 11: 76,750,878 T125A possibly damaging Het
Ifi27 T A 12: 103,439,943 probably null Het
Jph1 C T 1: 17,097,232 D125N possibly damaging Het
Kbtbd12 A T 6: 88,618,694 S51R probably damaging Het
Klra9 A T 6: 130,189,696 probably null Het
Kmo A T 1: 175,656,723 M340L probably benign Het
Lama1 T C 17: 67,717,186 I93T possibly damaging Het
Limk2 A T 11: 3,358,104 probably null Het
Mgat5 C A 1: 127,320,638 N92K probably benign Het
Mib2 T A 4: 155,654,799 I908F probably damaging Het
Mical1 T G 10: 41,480,363 L304R probably damaging Het
Myo3a T C 2: 22,564,992 Y70H probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Neurod2 G T 11: 98,327,203 N378K probably damaging Het
Olfr1051 T A 2: 86,275,993 T165S probably damaging Het
Olfr117 A G 17: 37,659,908 S142P probably benign Het
Olfr1286 T A 2: 111,420,658 M98L probably benign Het
Olfr986 A G 9: 40,187,865 Y250C probably damaging Het
Oog4 G A 4: 143,439,914 L107F probably damaging Het
Pfdn6 T C 17: 33,939,554 Y82C probably damaging Het
Pla2g4d C A 2: 120,277,490 A313S possibly damaging Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Rai1 A G 11: 60,187,602 T831A probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Rin1 A C 19: 5,055,143 I744L probably benign Het
Rora T A 9: 69,375,489 S430T probably benign Het
Rsph10b T A 5: 143,937,149 S23T probably damaging Het
Ryr1 T C 7: 29,047,503 N3773S probably benign Het
Scn4a A G 11: 106,339,354 Y543H probably damaging Het
Scn4a C A 11: 106,345,547 G296C probably benign Het
Scn7a T C 2: 66,705,103 T435A probably benign Het
Shank2 G T 7: 144,411,153 D833Y probably damaging Het
Slc9a2 T C 1: 40,763,610 S607P possibly damaging Het
Slx4 G A 16: 3,991,594 R346W probably damaging Het
Spata20 A T 11: 94,480,514 C675S probably benign Het
Suclg2 A T 6: 95,587,016 I196N probably damaging Het
Sv2b G A 7: 75,149,059 H272Y possibly damaging Het
Svep1 T C 4: 58,070,629 I2386V probably benign Het
Taf13 A T 3: 108,581,129 E109D possibly damaging Het
Tanc2 A G 11: 105,899,780 T976A probably benign Het
Tax1bp1 A G 6: 52,729,326 Y104C probably damaging Het
Tfeb T C 17: 47,788,986 probably null Het
Tlr9 T C 9: 106,224,049 Y180H probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttc12 T A 9: 49,445,199 T510S probably benign Het
Ubqln1 T C 13: 58,192,081 E280G probably damaging Het
Urm1 T C 2: 29,841,425 W44R probably damaging Het
Usp32 A T 11: 85,042,580 I34N probably benign Het
Vars T C 17: 35,014,752 L1018P probably damaging Het
Vcan A T 13: 89,721,775 V206D probably damaging Het
Vim T C 2: 13,578,459 V224A probably damaging Het
Vmn2r106 G T 17: 20,278,735 H305N probably benign Het
Vmn2r78 A G 7: 86,954,924 N770S probably damaging Het
Wdr33 T A 18: 31,896,631 L961Q unknown Het
Xylt2 A G 11: 94,668,749 S356P possibly damaging Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zc3h6 T C 2: 129,016,734 L895S probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Other mutations in Mtbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Mtbp APN 15 55617508 nonsense probably null
IGL00988:Mtbp APN 15 55558498 unclassified probably benign
IGL01608:Mtbp APN 15 55557689 nonsense probably null
IGL02422:Mtbp APN 15 55563043 missense possibly damaging 0.59
IGL02664:Mtbp APN 15 55619643 missense probably benign 0.01
IGL03160:Mtbp APN 15 55620617 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0280:Mtbp UTSW 15 55586461 missense probably benign 0.04
R0302:Mtbp UTSW 15 55625424 missense probably damaging 0.99
R0387:Mtbp UTSW 15 55611029 missense possibly damaging 0.82
R0402:Mtbp UTSW 15 55569070 nonsense probably null
R0648:Mtbp UTSW 15 55603201 missense probably benign
R0735:Mtbp UTSW 15 55562942 nonsense probably null
R0845:Mtbp UTSW 15 55563090 critical splice donor site probably null
R1186:Mtbp UTSW 15 55564671 missense probably null 1.00
R1398:Mtbp UTSW 15 55577537 nonsense probably null
R1500:Mtbp UTSW 15 55617555 missense probably damaging 0.99
R1893:Mtbp UTSW 15 55557668 missense probably benign 0.37
R1902:Mtbp UTSW 15 55606715 missense probably damaging 0.99
R1917:Mtbp UTSW 15 55564677 splice site probably benign
R2267:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2268:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2269:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2383:Mtbp UTSW 15 55566194 missense probably damaging 1.00
R2512:Mtbp UTSW 15 55577536 missense probably damaging 0.98
R2924:Mtbp UTSW 15 55619814 missense probably benign 0.21
R2925:Mtbp UTSW 15 55619814 missense probably benign 0.21
R4164:Mtbp UTSW 15 55609521 missense probably benign
R4232:Mtbp UTSW 15 55620677 nonsense probably null
R4255:Mtbp UTSW 15 55620685 missense possibly damaging 0.66
R4438:Mtbp UTSW 15 55603215 missense probably benign 0.41
R5009:Mtbp UTSW 15 55603187 missense probably benign
R5132:Mtbp UTSW 15 55558569 missense possibly damaging 0.92
R5685:Mtbp UTSW 15 55562772 missense probably damaging 1.00
R5933:Mtbp UTSW 15 55571327 missense possibly damaging 0.92
R6377:Mtbp UTSW 15 55557620 start codon destroyed probably null 0.32
R6554:Mtbp UTSW 15 55567249 missense probably damaging 0.99
R6811:Mtbp UTSW 15 55606546 intron probably null
R6942:Mtbp UTSW 15 55567200 missense probably damaging 0.99
R7134:Mtbp UTSW 15 55558565 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATATATGCATTCATGGGAGGGTGGGA -3'
(R):5'- ACCGCATCAAGGAAGCAAGGTTCA -3'

Sequencing Primer
(F):5'- TGGGAGAAAGAAATGGGGTG -3'
(R):5'- AGGTTCAGGCAGCTCCATATC -3'
Posted On2014-05-14