Incidental Mutation 'R1713:Arpp21'
ID190787
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
MMRRC Submission 039746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1713 (G1)
Quality Score220
Status Validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112067169 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 684 (S684P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159246] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000164754]
Predicted Effect probably benign
Transcript: ENSMUST00000035085
AA Change: S702P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503
AA Change: S702P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070218
AA Change: S722P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503
AA Change: S722P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111872
AA Change: S722P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503
AA Change: S722P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159246
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159432
Predicted Effect probably damaging
Transcript: ENSMUST00000160240
AA Change: S684P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162065
AA Change: S722P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503
AA Change: S722P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162097
AA Change: S720P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503
AA Change: S720P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164754
AA Change: S720P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503
AA Change: S720P

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Akap9 T C 5: 4,039,345 probably null Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
C4b A G 17: 34,729,271 probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dab2 C T 15: 6,429,701 P365S possibly damaging Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Top2b T C 14: 16,409,823 V830A probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0533:Arpp21 UTSW 9 112126505 missense probably benign 0.36
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1416:Arpp21 UTSW 9 112179129 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R2932:Arpp21 UTSW 9 112179105 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R5992:Arpp21 UTSW 9 112143485 nonsense probably null
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTGACGTTTGAATTCTAAGTCTC -3'
(R):5'- CTTTTGAAGCCATAACACTGTCCACAC -3'

Sequencing Primer
(F):5'- CTCAATTCAAAGTGAAGTAATGGGTG -3'
(R):5'- CATGGAGCCTGAGATGTCC -3'
Posted On2014-05-14