Incidental Mutation 'R1713:C4b'
ID190819
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 039746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1713 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 34729271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,270,767 I54F possibly damaging Het
Ackr1 A T 1: 173,332,349 H134Q probably benign Het
Agtr1b A T 3: 20,316,309 F44L probably benign Het
Ahnak G A 19: 9,011,809 D3486N possibly damaging Het
Akap9 T C 5: 4,039,345 probably null Het
Anks6 T A 4: 47,039,726 Q495L probably benign Het
Arpp21 A G 9: 112,067,169 S684P probably damaging Het
Ash1l A G 3: 89,076,224 E2911G probably damaging Het
Avpi1 C T 19: 42,124,809 E70K probably damaging Het
Btbd17 G T 11: 114,795,824 P9T probably benign Het
Carm1 T C 9: 21,586,489 V385A probably damaging Het
Casd1 A G 6: 4,624,104 D299G probably damaging Het
Clca1 T A 3: 145,024,546 K179N probably benign Het
Col1a2 T C 6: 4,538,691 S1204P unknown Het
Col24a1 C T 3: 145,366,869 Q780* probably null Het
Cxadr C A 16: 78,334,245 N216K probably damaging Het
Daam1 C T 12: 71,895,882 T40I unknown Het
Dab2 C T 15: 6,429,701 P365S possibly damaging Het
Dnah1 A T 14: 31,279,182 I2402N probably damaging Het
Dscaml1 T A 9: 45,752,690 S1954R possibly damaging Het
Dync2h1 T C 9: 7,131,891 T1639A probably benign Het
Ebf1 A T 11: 44,924,566 I336F probably damaging Het
Ebna1bp2 A G 4: 118,625,684 N290S possibly damaging Het
Gabra2 A G 5: 71,014,563 I110T probably benign Het
Galk2 A G 2: 125,931,290 N203S probably benign Het
Gria4 T C 9: 4,424,448 T806A probably benign Het
Impg2 A G 16: 56,260,526 T789A probably benign Het
Itga6 A G 2: 71,787,202 T22A probably benign Het
Itgb4 T A 11: 116,003,489 I1312N probably damaging Het
Kdm4c A G 4: 74,298,484 D160G probably benign Het
Kdr A G 5: 75,968,467 V173A probably benign Het
Kif14 T C 1: 136,527,464 S1575P probably benign Het
Lcp1 G A 14: 75,199,444 probably null Het
Lipe C A 7: 25,385,325 S516I probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Macf1 A G 4: 123,378,694 I6429T probably damaging Het
Map3k4 C T 17: 12,249,571 E1012K probably benign Het
Map3k5 T C 10: 20,110,847 F936L possibly damaging Het
Mllt3 A T 4: 87,783,664 N497K probably damaging Het
Moxd1 G A 10: 24,281,496 G342D probably damaging Het
Mtdh A C 15: 34,114,839 Q202H possibly damaging Het
Nav1 A G 1: 135,595,234 probably benign Het
Nop56 T C 2: 130,277,966 V109A possibly damaging Het
Obscn T C 11: 59,079,886 D2540G probably damaging Het
Olfr1121 A T 2: 87,371,946 Y138F probably damaging Het
Olfr1495 A T 19: 13,769,295 T318S probably benign Het
Omg T C 11: 79,502,853 I60V probably benign Het
Osbpl5 G A 7: 143,694,373 H652Y probably damaging Het
Papd7 A T 13: 69,503,051 I565N probably benign Het
Parvb T C 15: 84,297,991 probably benign Het
Pcdhb3 A C 18: 37,303,322 E780D probably benign Het
Pik3c3 A G 18: 30,323,586 D723G possibly damaging Het
Prkdc T C 16: 15,795,094 V3172A probably benign Het
Psme4 G T 11: 30,806,310 W272L probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rhobtb1 A C 10: 69,272,771 S434R probably benign Het
Rhobtb1 G C 10: 69,272,772 S434T possibly damaging Het
Rnf8 T C 17: 29,634,761 F413S probably damaging Het
Rpn2 A G 2: 157,314,968 N497S probably damaging Het
Rsbn1l G T 5: 20,951,490 P99Q probably benign Het
Serpinb3b A T 1: 107,155,434 M246K probably benign Het
Sgsm2 T C 11: 74,896,826 E19G probably null Het
Shank1 A G 7: 44,319,737 H352R unknown Het
Slc17a7 A G 7: 45,170,304 I177V probably benign Het
Slc28a2 T A 2: 122,451,013 F228I probably damaging Het
Slc35b4 C T 6: 34,170,549 V35I probably benign Het
Slc38a1 T C 15: 96,578,760 I407V probably damaging Het
Slc39a13 A G 2: 91,063,097 V326A probably damaging Het
Slc44a5 T C 3: 154,239,106 L120P probably damaging Het
Slfn3 T C 11: 83,213,314 I214T probably damaging Het
Slitrk3 A C 3: 73,049,691 S583A probably benign Het
Snx14 T C 9: 88,415,675 Y180C probably damaging Het
Sorl1 T A 9: 41,996,242 K1483I probably benign Het
Ssrp1 C A 2: 85,040,760 H247N probably damaging Het
Stk39 A T 2: 68,307,116 probably benign Het
Syde1 C T 10: 78,585,696 G674R probably damaging Het
Themis3 G A 17: 66,555,853 S370L probably benign Het
Tll1 T A 8: 64,101,873 N259Y probably damaging Het
Tnip2 T G 5: 34,503,831 probably benign Het
Top2b T C 14: 16,409,823 V830A probably benign Het
Trpm8 T A 1: 88,365,080 N934K probably damaging Het
Ttc14 A G 3: 33,802,920 Y179C probably damaging Het
Ttn T G 2: 76,743,621 I17316L possibly damaging Het
Tufm T C 7: 126,487,699 V52A probably benign Het
Vamp8 T A 6: 72,388,287 N20I probably benign Het
Vmn1r170 A T 7: 23,606,863 H230L probably benign Het
Vmn2r50 T G 7: 10,037,804 T657P probably damaging Het
Xirp2 G A 2: 67,512,418 G1668R probably benign Het
Zik1 C A 7: 10,490,384 R262L possibly damaging Het
Zscan25 T G 5: 145,283,691 Y99D probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGCTTCCTACAGAACTTGTTGC -3'
(R):5'- TTATCCCCGAGTGGAGTATGGTCAG -3'

Sequencing Primer
(F):5'- GCAAGCCCAGGTTCCTAATG -3'
(R):5'- AGTGGAGTATGGTCAGTCCCTC -3'
Posted On2014-05-14