Incidental Mutation 'R1715:Mbtps1'
ID190938
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
MMRRC Submission 039748-MU
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1715 (G1)
Quality Score121
Status Not validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119542730 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 207 (Y207C)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect probably benign
Transcript: ENSMUST00000081381
AA Change: Y207C

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: Y207C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098362
AA Change: Y207C

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: Y207C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212813
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1269:Mbtps1 UTSW 8 119520277 missense probably damaging 1.00
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1580:Mbtps1 UTSW 8 119538900 missense possibly damaging 0.79
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2910:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4611:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6056:Mbtps1 UTSW 8 119515602 missense probably benign
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAAGTCCCATACGAGATGCC -3'
(R):5'- GCAGTCATCACGTCCCCTGAAAAG -3'

Sequencing Primer
(F):5'- gcaatcctatacatacacatgcac -3'
(R):5'- AAGAGCCAGTCTCTCCCTG -3'
Posted On2014-05-14