Incidental Mutation 'R1715:Lrrc9'
ID190956
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72477299 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 761 (N761D)
Ref Sequence ENSEMBL: ENSMUSP00000124602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably damaging
Transcript: ENSMUST00000161284
AA Change: N761D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090
AA Change: N761D

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161957
Predicted Effect probably damaging
Transcript: ENSMUST00000162159
AA Change: N760D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: N760D

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196758
Predicted Effect probably damaging
Transcript: ENSMUST00000221360
AA Change: N761D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Ifna11 C T 4: 88,820,236 S93L probably damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72466966 missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72499679 missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72499692 missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTGCCATGACCCAGTGTG -3'
(R):5'- AGGAACAGGTGTGGTTTGCCTC -3'

Sequencing Primer
(F):5'- ATGACCCAGTGTGTTACCCTTAG -3'
(R):5'- CTTTCTGGCTTGGACTGACC -3'
Posted On2014-05-14