Incidental Mutation 'R1716:Reln'
ID190997
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 039749-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1716 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21955095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2159 (T2159A)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: T2159A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: T2159A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: T2159A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: T2159A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198176
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,082,198 T2A unknown Het
Adgrf3 T A 5: 30,197,551 Q493L probably benign Het
Ak6 T C 13: 100,655,669 S207P probably benign Het
Ang A G 14: 51,101,480 D26G probably benign Het
Ang T C 14: 51,101,500 F33L probably damaging Het
Arhgef38 T A 3: 133,140,837 Y389F probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bicd2 C A 13: 49,378,310 H343N probably benign Het
Casp4 G A 9: 5,308,919 probably null Het
Cd22 A G 7: 30,877,678 F68S probably damaging Het
Cd46 T A 1: 195,077,809 Q245L probably benign Het
Cntnap2 A T 6: 47,107,892 R1096* probably null Het
Cntnap3 A G 13: 64,762,002 V763A probably damaging Het
Cyp3a11 T C 5: 145,868,966 T171A probably benign Het
Defa30 A G 8: 21,135,415 Y65C probably damaging Het
Defb18 A T 1: 18,236,651 M27K probably benign Het
Dnah17 A G 11: 118,032,598 S4071P probably benign Het
Dnah7b T A 1: 46,191,783 D1400E probably damaging Het
Dpysl5 C T 5: 30,777,994 T147I probably benign Het
Dsg4 C T 18: 20,462,461 R574* probably null Het
Epm2a A G 10: 11,448,836 E223G probably benign Het
Etl4 T C 2: 20,743,681 S75P probably damaging Het
Fam189a1 A T 7: 64,776,885 probably null Het
Fbxw15 T A 9: 109,557,136 M312L probably benign Het
Fcgr4 C T 1: 171,020,103 T90I probably damaging Het
Fras1 T A 5: 96,552,725 D201E probably benign Het
Gadl1 A T 9: 116,006,508 K335* probably null Het
Gcsam T G 16: 45,619,993 V133G probably damaging Het
Gml G T 15: 74,813,816 L107I possibly damaging Het
Golga2 T A 2: 32,302,897 L409Q probably damaging Het
Gtf2a1l A T 17: 88,694,580 Q241L probably benign Het
Gtf3c3 A G 1: 54,399,260 Y799H probably damaging Het
Guca1b T G 17: 47,391,201 probably benign Het
Igdcc4 C A 9: 65,126,897 H617Q probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itga2b A C 11: 102,460,777 I574S probably benign Het
Kcnk7 A T 19: 5,706,831 I283F probably damaging Het
Kirrel3 T A 9: 35,023,547 L450M probably damaging Het
Lmntd1 A T 6: 145,419,874 S176R probably damaging Het
Lrrc39 C T 3: 116,579,567 T292I probably benign Het
Ltbp1 A T 17: 75,315,024 H801L probably benign Het
Macf1 T A 4: 123,401,403 Q3318L probably damaging Het
Man1b1 T A 2: 25,345,020 N282K probably benign Het
Map2k6 A T 11: 110,497,901 E223V probably damaging Het
Marf1 C A 16: 14,142,586 R531S possibly damaging Het
Mfge8 G A 7: 79,142,443 R245C probably damaging Het
Mgea5 C A 19: 45,752,174 K907N probably benign Het
Mogat1 T G 1: 78,538,044 N318K probably benign Het
Myh4 T A 11: 67,250,309 S732R possibly damaging Het
Myt1l T A 12: 29,811,538 D106E unknown Het
Ndc1 T C 4: 107,384,795 F302L probably damaging Het
Ndrg4 C T 8: 95,712,328 A290V probably benign Het
Nfia A T 4: 98,063,128 K397N probably damaging Het
Nlrp4e A T 7: 23,321,033 Q315L possibly damaging Het
Olfr51 T A 11: 51,007,852 N293K probably damaging Het
Olfr9 A C 10: 128,990,852 *313C probably null Het
Peg3 T C 7: 6,707,781 I1481V possibly damaging Het
Phldb2 C T 16: 45,775,050 G883D probably benign Het
Pik3c2b T A 1: 133,094,826 Y1169N probably damaging Het
Plcl1 A T 1: 55,695,838 I113F probably damaging Het
Pomt2 T C 12: 87,124,836 I457V probably benign Het
Ppil1 T C 17: 29,261,835 N38S possibly damaging Het
Prf1 A G 10: 61,300,452 N169S probably benign Het
Prmt8 A C 6: 127,726,523 probably null Het
Ptprg T A 14: 12,154,360 S694T probably benign Het
Rab12 A T 17: 66,500,320 M138K possibly damaging Het
Retsat A T 6: 72,606,080 Y36F probably damaging Het
Rgs14 A T 13: 55,378,883 Q116L probably damaging Het
Rlbp1 A T 7: 79,375,936 N252K probably damaging Het
Rtraf A G 14: 19,812,174 L215P probably damaging Het
Sec1 A T 7: 45,679,365 M86K probably benign Het
Sec24b A T 3: 130,041,016 S42T possibly damaging Het
Serpinb9d T C 13: 33,196,517 S129P probably damaging Het
Slc35f5 T G 1: 125,584,532 D356E possibly damaging Het
Smpd4 T C 16: 17,642,501 S694P probably damaging Het
Spag6 G T 2: 18,745,609 probably null Het
Spata31d1c T C 13: 65,033,216 I43T possibly damaging Het
Ssh1 T C 5: 113,952,020 D314G possibly damaging Het
Tnfrsf17 G A 16: 11,319,731 D111N probably benign Het
Ttn A G 2: 76,723,291 I30994T probably damaging Het
Ttn A T 2: 76,783,976 F8737L probably damaging Het
Ush1c G T 7: 46,195,728 F890L probably benign Het
Usp36 C T 11: 118,272,131 probably null Het
Vmn2r115 T C 17: 23,347,821 Y436H probably benign Het
Vmn2r94 T A 17: 18,257,373 M259L probably benign Het
Wwp1 T C 4: 19,659,698 T197A probably benign Het
Zbtb37 T A 1: 161,020,244 M398L probably benign Het
Zfp804b C T 5: 6,769,673 C1130Y probably benign Het
Zfp9 A G 6: 118,464,751 C317R probably damaging Het
Zscan20 T C 4: 128,586,541 H719R probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCACTAACTGCCATGTCAAAAGTGT -3'
(R):5'- GGTAACTTTGAGACCTCCTGTGCCT -3'

Sequencing Primer
(F):5'- TCAGAAAGAAATGGCCTTTTAGTG -3'
(R):5'- AGACCTCCTGTGCCTTGTTTTC -3'
Posted On2014-05-14