Incidental Mutation 'R1717:Zfhx4'
ID191095
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Namezinc finger homeodomain 4
SynonymsZfh4, C130041O22Rik, Zfh-4
MMRRC Submission 039750-MU
Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location5218526-5415857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5403104 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2799 (I2799T)
Ref Sequence ENSEMBL: ENSMUSP00000135827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
Predicted Effect probably benign
Transcript: ENSMUST00000026284
AA Change: I2774T

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: I2774T

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175866
AA Change: I2799T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: I2799T

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176383
AA Change: I2774T

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: I2774T

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5242341 missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5245523 missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5245347 missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5243568 missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5413094 missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5242328 missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5244284 missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5399327 missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5401136 missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5243976 missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5399462 missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5242045 missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5244092 missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5412709 missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5244304 splice site probably null
IGL02342:Zfhx4 APN 3 5402374 missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5399603 missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5411843 missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5399183 missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5329523 missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5412153 missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5243307 missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5390408 missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5242525 missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5403914 missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5401171 missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5411780 nonsense probably null
IGL03302:Zfhx4 APN 3 5403713 missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5403350 missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5411850 missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5403385 missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5403175 missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5399539 missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5243733 missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5399588 missense probably benign 0.04
PIT4377001:Zfhx4 UTSW 3 5242742 missense probably damaging 0.98
R0090:Zfhx4 UTSW 3 5243625 missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5398982 missense probably damaging 1.00
R0401:Zfhx4 UTSW 3 5401161 missense possibly damaging 0.87
R0465:Zfhx4 UTSW 3 5245656 splice site probably benign
R0506:Zfhx4 UTSW 3 5402735 missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5400988 nonsense probably null
R0550:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5402101 missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5402633 missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5401733 missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5401073 missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5403820 missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5412212 missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5399870 missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5400831 small deletion probably benign
R1338:Zfhx4 UTSW 3 5396961 missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5401387 missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5241859 missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1552:Zfhx4 UTSW 3 5403110 missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5241729 missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5400413 missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5413016 missense probably damaging 1.00
R1739:Zfhx4 UTSW 3 5401730 missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5382616 missense probably benign
R1842:Zfhx4 UTSW 3 5401498 missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5398927 missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5403163 missense possibly damaging 0.58
R2154:Zfhx4 UTSW 3 5401741 missense possibly damaging 0.86
R2165:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5403332 missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5242289 missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5396918 missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5397060 missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2520:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5245143 missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5403664 missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5403654 missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5399326 missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5403823 missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5403344 missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5400785 missense probably benign
R3919:Zfhx4 UTSW 3 5399115 missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5400647 missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5403847 missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5398859 missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5399324 missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5243627 missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5403345 nonsense probably null
R4439:Zfhx4 UTSW 3 5214815 unclassified probably benign
R4497:Zfhx4 UTSW 3 5399620 missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5412518 missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5401834 missense probably benign 0.00
R4612:Zfhx4 UTSW 3 5397063 missense probably damaging 1.00
R4616:Zfhx4 UTSW 3 5413067 missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5402639 missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5403476 missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5403404 missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5399281 missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5245503 unclassified probably null
R4729:Zfhx4 UTSW 3 5399497 missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5214807 unclassified probably benign
R4757:Zfhx4 UTSW 3 5400062 missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5400152 missense probably benign
R4819:Zfhx4 UTSW 3 5403914 missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5242011 missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5398979 missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5242047 missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5403641 missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5399207 missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5412425 missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5243007 missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5403138 missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5403619 missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5403321 missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5402620 missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5402659 missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5402138 missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5396970 missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5403427 missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5396959 missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5398811 missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5401951 missense probably benign
R6374:Zfhx4 UTSW 3 5244035 missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5243350 missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5413110 missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5243145 missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5242428 missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5244108 missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5241837 missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5412987 missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5403830 missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5402489 missense probably damaging 0.97
R7127:Zfhx4 UTSW 3 5413044 missense probably damaging 0.99
R7138:Zfhx4 UTSW 3 5412047 missense possibly damaging 0.69
R7161:Zfhx4 UTSW 3 5244083 missense possibly damaging 0.65
R7213:Zfhx4 UTSW 3 5396644 missense probably benign
R7483:Zfhx4 UTSW 3 5412177 missense probably damaging 0.98
R7514:Zfhx4 UTSW 3 5242207 missense possibly damaging 0.91
R7544:Zfhx4 UTSW 3 5412815 missense probably damaging 0.98
R7565:Zfhx4 UTSW 3 5390366 missense probably benign 0.04
X0025:Zfhx4 UTSW 3 5411836 missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5412338 missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5402414 missense probably benign 0.13
X0028:Zfhx4 UTSW 3 5403267 missense probably damaging 1.00
X0054:Zfhx4 UTSW 3 5399710 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAAAGCCACATTCGCTCTCGCC -3'
(R):5'- GTCAGCATTGTCGTCAGGGTCATC -3'

Sequencing Primer
(F):5'- CTACTGAGAATGAATTGGCCTCC -3'
(R):5'- GGTCATCCGTGATGTAAAAGC -3'
Posted On2014-05-14