Incidental Mutation 'R1717:Arhgef7'
ID191121
Institutional Source Beutler Lab
Gene Symbol Arhgef7
Ensembl Gene ENSMUSG00000031511
Gene NameRho guanine nucleotide exchange factor (GEF7)
Synonymscool-1, betaPix, Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-b, betaPix-c
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11727721-11835219 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 11808713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074856] [ENSMUST00000098938] [ENSMUST00000110904] [ENSMUST00000110909] [ENSMUST00000210012]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033908
SMART Domains Protein: ENSMUSP00000033908
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
low complexity region 600 614 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 660 672 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074856
SMART Domains Protein: ENSMUSP00000074399
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
PDB:3L4F|C 587 646 2e-32 PDB
Predicted Effect probably null
Transcript: ENSMUST00000098938
SMART Domains Protein: ENSMUSP00000096538
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
low complexity region 569 600 N/A INTRINSIC
PDB:3L4F|C 646 705 2e-32 PDB
Predicted Effect probably null
Transcript: ENSMUST00000110904
SMART Domains Protein: ENSMUSP00000106529
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 428 440 N/A INTRINSIC
low complexity region 494 525 N/A INTRINSIC
PDB:3L4F|C 571 630 2e-32 PDB
Predicted Effect probably null
Transcript: ENSMUST00000110909
SMART Domains Protein: ENSMUSP00000106534
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
Pfam:RhoGEF67_u1 117 163 8e-21 PFAM
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
Pfam:RhoGEF67_u2 611 711 2.3e-53 PFAM
low complexity region 726 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154204
Predicted Effect probably benign
Transcript: ENSMUST00000210012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211510
Meta Mutation Damage Score 0.6096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Arhgef7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgef7 APN 8 11782540 missense probably damaging 1.00
IGL01481:Arhgef7 APN 8 11815256 missense probably benign 0.01
IGL02376:Arhgef7 APN 8 11817735 missense probably damaging 1.00
IGL02812:Arhgef7 APN 8 11781245 unclassified probably benign
IGL02813:Arhgef7 APN 8 11800767 unclassified probably benign
IGL02864:Arhgef7 APN 8 11815247 missense possibly damaging 0.49
Mental_fitness UTSW 8 11800811 missense probably damaging 1.00
R0139:Arhgef7 UTSW 8 11800503 missense probably damaging 0.99
R0157:Arhgef7 UTSW 8 11785812 missense probably damaging 1.00
R0332:Arhgef7 UTSW 8 11824701 nonsense probably null
R0448:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R0973:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R1491:Arhgef7 UTSW 8 11819733 critical splice donor site probably null
R1566:Arhgef7 UTSW 8 11782620 missense possibly damaging 0.85
R1601:Arhgef7 UTSW 8 11782638 unclassified probably null
R1716:Arhgef7 UTSW 8 11808713 splice site probably null
R1717:Arhgef7 UTSW 8 11808712 unclassified probably benign
R1719:Arhgef7 UTSW 8 11808713 splice site probably null
R1901:Arhgef7 UTSW 8 11808713 splice site probably null
R1902:Arhgef7 UTSW 8 11808713 splice site probably null
R1933:Arhgef7 UTSW 8 11808713 splice site probably null
R1934:Arhgef7 UTSW 8 11808713 splice site probably null
R1956:Arhgef7 UTSW 8 11805266 missense probably damaging 1.00
R2122:Arhgef7 UTSW 8 11728256 missense possibly damaging 0.94
R2273:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2275:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2306:Arhgef7 UTSW 8 11812680 nonsense probably null
R2375:Arhgef7 UTSW 8 11814995 missense probably benign 0.08
R4530:Arhgef7 UTSW 8 11800802 missense possibly damaging 0.60
R4805:Arhgef7 UTSW 8 11831552 missense probably damaging 1.00
R5204:Arhgef7 UTSW 8 11800775 nonsense probably null
R5212:Arhgef7 UTSW 8 11728388 missense probably benign 0.40
R5256:Arhgef7 UTSW 8 11800811 missense probably damaging 1.00
R5718:Arhgef7 UTSW 8 11785774 missense probably damaging 1.00
R6195:Arhgef7 UTSW 8 11822017 missense probably damaging 1.00
R6503:Arhgef7 UTSW 8 11833054 missense possibly damaging 0.58
R6679:Arhgef7 UTSW 8 11824667 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGGACAGCTTATTGCAGCTCTTACC -3'
(R):5'- GCCTGACATTAAGGATGGCTCAGAC -3'

Sequencing Primer
(F):5'- TCTAAAGGTCTCCGTGAAGC -3'
(R):5'- TGGCTCAGACCAGGGAG -3'
Posted On2014-05-14