Incidental Mutation 'R1717:Cdh8'
ID191125
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission 039750-MU
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99030705 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 754 (S754T)
Ref Sequence ENSEMBL: ENSMUSP00000117326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000145601] [ENSMUST00000155527]
PDB Structure
Crystal Structure of Cadherin8 EC1 domain [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-8 EC1-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000093249
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128860
AA Change: S754T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510
AA Change: S754T

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142129
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145601
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155527
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161244
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACATTTGTTGCATCTAAGGGG -3'
(R):5'- TCATTCGCTACGACGACGAAGGAG -3'

Sequencing Primer
(F):5'- TTGCATCTAAGGGGAGTGACC -3'
(R):5'- AGGCTTTTGACATTGCAACTTTG -3'
Posted On2014-05-14