Incidental Mutation 'R1717:Slc12a4'
ID191128
Institutional Source Beutler Lab
Gene Symbol Slc12a4
Ensembl Gene ENSMUSG00000017765
Gene Namesolute carrier family 12, member 4
SynonymsKCC1, K-Cl Co-transporter-1
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105943590-105966097 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 105947571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably damaging
Transcript: ENSMUST00000034370
AA Change: M632K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: M632K

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038896
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116429
AA Change: M630K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: M630K

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183884
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Slc12a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Slc12a4 APN 8 105944089 missense probably damaging 1.00
IGL01637:Slc12a4 APN 8 105960707 missense possibly damaging 0.72
IGL01736:Slc12a4 APN 8 105945843 critical splice donor site probably null
IGL01804:Slc12a4 APN 8 105944401 missense probably damaging 1.00
IGL02000:Slc12a4 APN 8 105945232 missense probably damaging 1.00
IGL02526:Slc12a4 APN 8 105949806 missense possibly damaging 0.90
IGL03371:Slc12a4 APN 8 105950505 missense probably null 0.99
IGL03385:Slc12a4 APN 8 105950864 unclassified probably benign
R0033:Slc12a4 UTSW 8 105947479 splice site probably benign
R0200:Slc12a4 UTSW 8 105951617 missense probably benign 0.09
R0201:Slc12a4 UTSW 8 105945350 missense possibly damaging 0.79
R0270:Slc12a4 UTSW 8 105945389 missense probably benign 0.10
R0389:Slc12a4 UTSW 8 105951967 missense probably benign 0.00
R0432:Slc12a4 UTSW 8 105959488 missense probably damaging 1.00
R0751:Slc12a4 UTSW 8 105951900 missense probably damaging 1.00
R1792:Slc12a4 UTSW 8 105951843 missense possibly damaging 0.91
R1940:Slc12a4 UTSW 8 105946037 missense probably benign 0.29
R3115:Slc12a4 UTSW 8 105959459 missense probably damaging 1.00
R4898:Slc12a4 UTSW 8 105944609 missense probably damaging 1.00
R5182:Slc12a4 UTSW 8 105944606 missense probably damaging 1.00
R5220:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R5283:Slc12a4 UTSW 8 105950694 critical splice donor site probably null
R5367:Slc12a4 UTSW 8 105951634 missense probably damaging 0.99
R5610:Slc12a4 UTSW 8 105950213 missense possibly damaging 0.87
R5921:Slc12a4 UTSW 8 105945244 critical splice acceptor site probably null
R6060:Slc12a4 UTSW 8 105945706 missense probably damaging 1.00
R6182:Slc12a4 UTSW 8 105947899 missense probably damaging 1.00
R6722:Slc12a4 UTSW 8 105944250 intron probably null
R6800:Slc12a4 UTSW 8 105949739 missense probably damaging 1.00
R6956:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
X0019:Slc12a4 UTSW 8 105944352 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGATGTCACCACAAGCCACTG -3'
(R):5'- GAATGGAGACCTGACCTGCTTCAC -3'

Sequencing Primer
(F):5'- ACTGAGCCCCTGGTTCAC -3'
(R):5'- ACACATCCAGCTTGTGACTTG -3'
Posted On2014-05-14