Incidental Mutation 'R1717:Lrp1'
ID191141
Institutional Source Beutler Lab
Gene Symbol Lrp1
Ensembl Gene ENSMUSG00000040249
Gene Namelow density lipoprotein receptor-related protein 1
SynonymsA2mr, b2b1554Clo, CD91
MMRRC Submission 039750-MU
Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1717 (G1)
Quality Score168
Status Validated
Chromosome10
Chromosomal Location127538161-127621148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127556269 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 2835 (H2835R)
Ref Sequence ENSEMBL: ENSMUSP00000044004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049149
AA Change: H2835R

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: H2835R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
EGF 807 844 1.38e1 SMART
LDLa 854 893 3.39e-16 SMART
LDLa 895 934 1.73e-13 SMART
LDLa 936 974 4.47e-16 SMART
LDLa 976 1014 2.53e-15 SMART
LDLa 1015 1054 2.95e-16 SMART
LDLa 1062 1100 3.24e-13 SMART
LDLa 1104 1143 2.97e-12 SMART
LDLa 1145 1185 1.24e-9 SMART
EGF 1185 1223 4.97e-1 SMART
EGF 1227 1263 6.02e0 SMART
LY 1290 1332 3.76e-1 SMART
LY 1337 1379 8.56e-14 SMART
LY 1380 1424 8.43e-13 SMART
LY 1425 1469 3.05e-10 SMART
LY 1471 1513 3.88e-3 SMART
EGF 1540 1580 1.85e0 SMART
LY 1606 1650 2.83e-5 SMART
LY 1651 1695 2.01e-10 SMART
LY 1698 1735 1.87e-5 SMART
LY 1736 1777 3.54e-6 SMART
LY 1778 1820 4.17e1 SMART
EGF 1850 1888 1.24e-1 SMART
LY 1915 1957 3.2e-4 SMART
LY 1958 2000 2.33e-15 SMART
LY 2001 2044 7.45e-14 SMART
LY 2045 2087 3.87e-12 SMART
LY 2089 2131 1.37e0 SMART
EGF 2159 2196 1.66e1 SMART
LY 2276 2318 5.57e-4 SMART
LY 2324 2369 3.3e-6 SMART
LY 2370 2412 3.93e-13 SMART
LY 2413 2454 3.62e-3 SMART
EGF_like 2482 2519 3.16e1 SMART
LDLa 2524 2564 3.31e-10 SMART
LDLa 2566 2603 7.21e-11 SMART
LDLa 2605 2642 1.09e-10 SMART
LDLa 2660 2691 6.05e-4 SMART
LDLa 2696 2733 2.49e-14 SMART
LDLa 2734 2772 4.65e-14 SMART
LDLa 2774 2815 3.92e-12 SMART
LDLa 2818 2856 1.51e-13 SMART
LDLa 2858 2900 1.93e-11 SMART
LDLa 2904 2942 1.73e-13 SMART
EGF_CA 2941 2982 6.16e-6 SMART
EGF_CA 2983 3023 2.66e-10 SMART
LY 3050 3094 6.64e-11 SMART
LY 3095 3137 7.17e-16 SMART
LY 3138 3181 4.28e-14 SMART
LY 3182 3224 8.11e-15 SMART
LY 3225 3265 1.44e-6 SMART
EGF 3294 3332 1.02e-2 SMART
LDLa 3334 3372 2.25e-12 SMART
LDLa 3374 3411 9.81e-13 SMART
LDLa 3413 3451 9.81e-13 SMART
LDLa 3453 3492 5.67e-18 SMART
LDLa 3494 3534 7.15e-15 SMART
LDLa 3536 3573 1.79e-15 SMART
EGF_like 3575 3611 4.83e1 SMART
LDLa 3575 3612 1.92e-15 SMART
LDLa 3613 3650 1.18e-15 SMART
LDLa 3654 3693 7.55e-14 SMART
LDLa 3695 3734 1.14e-8 SMART
LDLa 3741 3779 6.28e-11 SMART
EGF 3785 3824 1.06e1 SMART
EGF 3828 3862 1.51e0 SMART
LY 3893 3935 9.43e0 SMART
LY 3951 3993 1.23e-14 SMART
LY 3994 4037 2.98e-13 SMART
LY 4038 4080 4.28e-14 SMART
EGF 4151 4184 3.76e-1 SMART
low complexity region 4185 4198 N/A INTRINSIC
EGF 4200 4233 3.82e-2 SMART
EGF 4236 4269 4.03e-1 SMART
EGF 4272 4305 5.2e-4 SMART
EGF 4308 4341 1.22e0 SMART
EGF_like 4344 4376 4.11e1 SMART
EGF 4377 4410 5.12e-3 SMART
transmembrane domain 4423 4445 N/A INTRINSIC
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Lrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Lrp1 APN 10 127542205 missense possibly damaging 0.89
IGL01065:Lrp1 APN 10 127575038 missense probably benign 0.10
IGL01121:Lrp1 APN 10 127583853 nonsense probably null
IGL01360:Lrp1 APN 10 127545820 missense possibly damaging 0.93
IGL01402:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01404:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01411:Lrp1 APN 10 127581765 nonsense probably null
IGL01469:Lrp1 APN 10 127584414 missense probably damaging 1.00
IGL01552:Lrp1 APN 10 127588510 nonsense probably null
IGL01682:Lrp1 APN 10 127574978 missense probably benign 0.00
IGL01760:Lrp1 APN 10 127573501 missense probably benign 0.00
IGL01918:Lrp1 APN 10 127554589 missense probably damaging 0.99
IGL01989:Lrp1 APN 10 127578129 missense probably damaging 1.00
IGL02105:Lrp1 APN 10 127544579 missense probably damaging 1.00
IGL02158:Lrp1 APN 10 127554271 missense probably benign 0.02
IGL02164:Lrp1 APN 10 127563667 missense probably benign 0.39
IGL02337:Lrp1 APN 10 127576887 missense possibly damaging 0.87
IGL02425:Lrp1 APN 10 127571887 critical splice donor site probably null
IGL02493:Lrp1 APN 10 127581778 missense probably damaging 0.99
IGL02563:Lrp1 APN 10 127551686 missense probably damaging 1.00
IGL02590:Lrp1 APN 10 127552791 missense probably damaging 1.00
IGL02624:Lrp1 APN 10 127572422 missense probably damaging 0.98
IGL02625:Lrp1 APN 10 127574486 missense probably damaging 1.00
IGL02825:Lrp1 APN 10 127542605 missense probably damaging 1.00
IGL02880:Lrp1 APN 10 127540222 missense probably benign 0.12
IGL02900:Lrp1 APN 10 127576647 splice site probably benign
IGL02956:Lrp1 APN 10 127544559 missense probably benign 0.00
IGL02974:Lrp1 APN 10 127555016 missense probably damaging 0.99
IGL02983:Lrp1 APN 10 127550199 missense probably damaging 1.00
IGL03002:Lrp1 APN 10 127589636 missense probably damaging 1.00
IGL03091:Lrp1 APN 10 127559124 missense probably benign 0.30
IGL03109:Lrp1 APN 10 127566645 missense probably benign
IGL03194:Lrp1 APN 10 127568685 missense probably damaging 1.00
IGL03232:Lrp1 APN 10 127539376 missense probably damaging 1.00
P0015:Lrp1 UTSW 10 127566663 missense probably damaging 0.99
R0004:Lrp1 UTSW 10 127541825 splice site probably null
R0034:Lrp1 UTSW 10 127545651 missense probably benign 0.42
R0091:Lrp1 UTSW 10 127540979 missense probably damaging 1.00
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0143:Lrp1 UTSW 10 127593942 missense probably damaging 1.00
R0372:Lrp1 UTSW 10 127592136 missense probably damaging 1.00
R0379:Lrp1 UTSW 10 127594969 missense probably damaging 1.00
R0445:Lrp1 UTSW 10 127590636 nonsense probably null
R0529:Lrp1 UTSW 10 127541594 intron probably null
R0551:Lrp1 UTSW 10 127571958 missense probably benign
R0570:Lrp1 UTSW 10 127555009 nonsense probably null
R0600:Lrp1 UTSW 10 127567383 missense probably benign 0.00
R0626:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0647:Lrp1 UTSW 10 127571477 missense probably damaging 1.00
R0680:Lrp1 UTSW 10 127589661 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R0848:Lrp1 UTSW 10 127553362 splice site probably null
R0866:Lrp1 UTSW 10 127539278 missense probably damaging 1.00
R0918:Lrp1 UTSW 10 127593965 missense probably damaging 1.00
R1076:Lrp1 UTSW 10 127563797 splice site probably benign
R1107:Lrp1 UTSW 10 127557435 missense probably damaging 1.00
R1346:Lrp1 UTSW 10 127605866 missense probably damaging 1.00
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1496:Lrp1 UTSW 10 127539011 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R1525:Lrp1 UTSW 10 127539529 missense probably damaging 1.00
R1539:Lrp1 UTSW 10 127584381 unclassified probably null
R1589:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1591:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1663:Lrp1 UTSW 10 127556921 missense probably damaging 1.00
R1682:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R1717:Lrp1 UTSW 10 127563665 missense probably damaging 1.00
R1758:Lrp1 UTSW 10 127588584 missense possibly damaging 0.76
R1826:Lrp1 UTSW 10 127553707 missense probably damaging 1.00
R1842:Lrp1 UTSW 10 127573468 missense possibly damaging 0.93
R1844:Lrp1 UTSW 10 127595283 critical splice donor site probably null
R1845:Lrp1 UTSW 10 127578673 missense probably damaging 1.00
R1896:Lrp1 UTSW 10 127559998 missense possibly damaging 0.64
R1952:Lrp1 UTSW 10 127567431 missense probably damaging 1.00
R2009:Lrp1 UTSW 10 127544516 missense probably damaging 1.00
R2015:Lrp1 UTSW 10 127540694 missense probably benign 0.00
R2116:Lrp1 UTSW 10 127576493 nonsense probably null
R2161:Lrp1 UTSW 10 127555738 missense probably damaging 1.00
R2199:Lrp1 UTSW 10 127546840 missense probably damaging 1.00
R2213:Lrp1 UTSW 10 127540702 missense probably damaging 1.00
R2300:Lrp1 UTSW 10 127556915 nonsense probably null
R2324:Lrp1 UTSW 10 127566586 missense possibly damaging 0.92
R2849:Lrp1 UTSW 10 127542296 missense probably damaging 1.00
R2926:Lrp1 UTSW 10 127588113 missense probably damaging 0.98
R2993:Lrp1 UTSW 10 127610381 missense probably damaging 1.00
R3522:Lrp1 UTSW 10 127553555 missense probably damaging 1.00
R3702:Lrp1 UTSW 10 127595103 missense probably damaging 1.00
R3789:Lrp1 UTSW 10 127571969 missense possibly damaging 0.94
R3898:Lrp1 UTSW 10 127592100 nonsense probably null
R3941:Lrp1 UTSW 10 127553396 missense probably damaging 1.00
R3958:Lrp1 UTSW 10 127571958 missense probably benign
R4369:Lrp1 UTSW 10 127550286 missense possibly damaging 0.87
R4510:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4511:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4576:Lrp1 UTSW 10 127540188 small deletion probably benign
R4583:Lrp1 UTSW 10 127541372 missense probably benign 0.00
R4662:Lrp1 UTSW 10 127552185 nonsense probably null
R4721:Lrp1 UTSW 10 127555059 missense possibly damaging 0.58
R4728:Lrp1 UTSW 10 127563737 missense probably damaging 1.00
R4745:Lrp1 UTSW 10 127549944 missense probably benign 0.20
R4785:Lrp1 UTSW 10 127558133 missense probably benign 0.12
R4841:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4842:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4855:Lrp1 UTSW 10 127610442 missense probably benign 0.03
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4891:Lrp1 UTSW 10 127541752 missense probably damaging 1.00
R4925:Lrp1 UTSW 10 127575075 nonsense probably null
R4970:Lrp1 UTSW 10 127539520 missense probably benign 0.11
R4999:Lrp1 UTSW 10 127553779 missense probably damaging 1.00
R5044:Lrp1 UTSW 10 127567495 missense probably damaging 1.00
R5127:Lrp1 UTSW 10 127539634 intron probably benign
R5188:Lrp1 UTSW 10 127607952 missense probably damaging 1.00
R5218:Lrp1 UTSW 10 127548619 missense probably damaging 1.00
R5225:Lrp1 UTSW 10 127556096 missense probably benign 0.04
R5291:Lrp1 UTSW 10 127593878 missense probably damaging 1.00
R5386:Lrp1 UTSW 10 127592114 missense probably damaging 1.00
R5395:Lrp1 UTSW 10 127595297 missense probably damaging 1.00
R5413:Lrp1 UTSW 10 127588067 critical splice donor site probably null
R5430:Lrp1 UTSW 10 127541061 missense probably damaging 0.99
R5499:Lrp1 UTSW 10 127572944 missense possibly damaging 0.58
R5526:Lrp1 UTSW 10 127555724 missense probably benign 0.37
R5580:Lrp1 UTSW 10 127588520 missense probably benign
R5583:Lrp1 UTSW 10 127588463 missense probably benign 0.08
R5599:Lrp1 UTSW 10 127593869 missense probably damaging 1.00
R5639:Lrp1 UTSW 10 127593839 missense probably damaging 0.99
R5677:Lrp1 UTSW 10 127574429 missense probably damaging 1.00
R5730:Lrp1 UTSW 10 127583834 missense probably benign 0.00
R5742:Lrp1 UTSW 10 127548347 missense probably damaging 0.98
R5764:Lrp1 UTSW 10 127595318 missense probably benign 0.41
R5864:Lrp1 UTSW 10 127567505 missense possibly damaging 0.58
R5937:Lrp1 UTSW 10 127583876 missense possibly damaging 0.93
R5947:Lrp1 UTSW 10 127589554 critical splice donor site probably null
R5976:Lrp1 UTSW 10 127583901 missense probably damaging 1.00
R6021:Lrp1 UTSW 10 127578014 missense probably damaging 1.00
R6026:Lrp1 UTSW 10 127573403 missense probably damaging 1.00
R6045:Lrp1 UTSW 10 127566600 missense probably damaging 0.98
R6057:Lrp1 UTSW 10 127567490 missense probably damaging 1.00
R6084:Lrp1 UTSW 10 127560553 missense probably benign 0.09
R6131:Lrp1 UTSW 10 127560157 missense probably benign
R6235:Lrp1 UTSW 10 127588177 missense probably damaging 1.00
R6280:Lrp1 UTSW 10 127589584 missense probably benign 0.04
R6307:Lrp1 UTSW 10 127592075 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127541682 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127549407 missense probably damaging 1.00
R6536:Lrp1 UTSW 10 127558068 splice site probably null
R6605:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6607:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6631:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R6676:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6678:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6809:Lrp1 UTSW 10 127555056 missense probably benign 0.04
R6884:Lrp1 UTSW 10 127559117 missense probably benign 0.00
R6925:Lrp1 UTSW 10 127556988 missense probably benign 0.00
R6987:Lrp1 UTSW 10 127575005 missense probably damaging 1.00
V3553:Lrp1 UTSW 10 127571442 missense probably damaging 1.00
Y5406:Lrp1 UTSW 10 127554283 missense probably damaging 1.00
Z1088:Lrp1 UTSW 10 127584379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCATTGGGGCCGCAGGTTG -3'
(R):5'- GCCGTGCGTTTAAGGAGATCACAG -3'

Sequencing Primer
(F):5'- ACTCACCACACTCAGGGGATT -3'
(R):5'- GCTACCACTCATGTTGCAGG -3'
Posted On2014-05-14