Incidental Mutation 'R1717:Arvcf'
ID191163
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Namearmadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18348182-18407076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18401569 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 568 (K568E)
Ref Sequence ENSEMBL: ENSMUSP00000155883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090103] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000232025] [ENSMUST00000232241]
Predicted Effect probably benign
Transcript: ENSMUST00000090103
AA Change: K632E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: K632E

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115610
AA Change: K562E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325
AA Change: K562E

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115612
AA Change: K626E

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: K626E

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115613
AA Change: K632E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: K632E

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115614
AA Change: K626E

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: K626E

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126183
Predicted Effect possibly damaging
Transcript: ENSMUST00000150253
AA Change: K562E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231791
Predicted Effect possibly damaging
Transcript: ENSMUST00000232025
AA Change: K568E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000232241
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18403900 missense probably damaging 1.00
IGL02901:Arvcf APN 16 18398242 missense probably damaging 0.99
IGL03218:Arvcf APN 16 18404125 splice site probably benign
IGL03239:Arvcf APN 16 18397067 missense probably damaging 1.00
R0045:Arvcf UTSW 16 18403458 missense probably benign 0.40
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0873:Arvcf UTSW 16 18400205 nonsense probably null
R1227:Arvcf UTSW 16 18389304 missense probably benign 0.00
R1495:Arvcf UTSW 16 18389386 missense probably damaging 0.96
R2021:Arvcf UTSW 16 18399732 missense probably damaging 1.00
R3873:Arvcf UTSW 16 18403033 missense probably damaging 1.00
R4095:Arvcf UTSW 16 18401577 missense probably damaging 1.00
R4280:Arvcf UTSW 16 18397991 missense probably damaging 1.00
R4496:Arvcf UTSW 16 18405182 missense probably damaging 0.96
R4887:Arvcf UTSW 16 18398113 nonsense probably null
R5068:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5069:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5070:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5322:Arvcf UTSW 16 18397643 missense probably benign 0.00
R5400:Arvcf UTSW 16 18399070 missense probably benign 0.17
R6376:Arvcf UTSW 16 18405132 missense probably damaging 0.98
R6771:Arvcf UTSW 16 18403864 missense probably benign
Z1088:Arvcf UTSW 16 18402641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAATGCCCCTGATGAGAGGGAG -3'
(R):5'- ACTTGCTGCATGACTAGGAAAGAGC -3'

Sequencing Primer
(F):5'- CCTACGTACTCAGGACATGGTTAG -3'
(R):5'- TCTAGGGAACCCCACTCTGATG -3'
Posted On2014-05-14