Incidental Mutation 'R1717:Muc4'
ID191164
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Namemucin 4
Synonyms4933405I11Rik
MMRRC Submission 039750-MU
Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1717 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32735886-32782391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32753405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1094 (T1094A)
Ref Sequence ENSEMBL: ENSMUSP00000093813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096106
AA Change: T1094A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: T1094A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132475
SMART Domains Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 38 45 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 99 127 N/A INTRINSIC
low complexity region 148 173 N/A INTRINSIC
low complexity region 192 224 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135753
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00088:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00089:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00090:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00091:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00092:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00163:Muc4 APN 16 32754090 missense probably benign 0.20
IGL00324:Muc4 APN 16 32778812 missense probably benign 0.03
IGL00331:Muc4 APN 16 32753185 missense probably benign 0.01
IGL00539:Muc4 APN 16 32750910 missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32754347 missense probably benign 0.10
IGL00990:Muc4 APN 16 32753955 missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32755805 unclassified probably benign
IGL00990:Muc4 APN 16 32753823 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753848 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753849 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753863 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753886 missense probably benign 0.01
IGL00990:Muc4 APN 16 32752569 missense probably benign 0.01
IGL00990:Muc4 APN 16 32754071 missense probably benign 0.01
IGL01091:Muc4 APN 16 32753927 missense probably benign 0.04
IGL01124:Muc4 APN 16 32768730 missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32753901 missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32763966 missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32750655 missense probably benign 0.23
IGL01618:Muc4 APN 16 32756627 missense unknown
IGL01625:Muc4 APN 16 32755544 unclassified probably benign
IGL01626:Muc4 APN 16 32736402 missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32761348 splice site probably null
IGL01682:Muc4 APN 16 32754086 missense probably benign 0.35
IGL01870:Muc4 APN 16 32753196 missense probably benign 0.01
IGL01966:Muc4 APN 16 32751426 missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32754265 missense probably benign 0.01
IGL02089:Muc4 APN 16 32751313 missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32777649 splice site probably benign
IGL02210:Muc4 APN 16 32752254 missense probably benign 0.00
IGL02278:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02280:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02316:Muc4 APN 16 32750850 missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32752076 missense probably benign 0.41
IGL02449:Muc4 APN 16 32756129 unclassified probably benign
IGL02607:Muc4 APN 16 32775819 missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32755282 unclassified probably benign
IGL02893:Muc4 APN 16 32751648 missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32750394 missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32752048 missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32751948 missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32751439 nonsense probably null
IGL03335:Muc4 APN 16 32753021 missense probably benign 0.01
IGL03411:Muc4 APN 16 32754318 missense probably benign 0.01
3-1:Muc4 UTSW 16 32760251 splice site probably benign
3-1:Muc4 UTSW 16 32770394 missense possibly damaging 0.86
IGL02835:Muc4 UTSW 16 32763945 missense probably benign 0.32
P0035:Muc4 UTSW 16 32760248 splice site probably benign
PIT4131001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755699 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32754529 missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32755684 unclassified probably benign
R0119:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32771604 missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32765746 missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32755690 unclassified probably benign
R0299:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32752905 missense probably benign 0.00
R0462:Muc4 UTSW 16 32762536 missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32751069 missense probably benign 0.01
R0508:Muc4 UTSW 16 32751313 missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32756746 missense unknown
R0578:Muc4 UTSW 16 32755690 unclassified probably benign
R0617:Muc4 UTSW 16 32752107 missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32751670 missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32769827 missense probably damaging 0.99
R0727:Muc4 UTSW 16 32769847 missense probably benign 0.01
R0776:Muc4 UTSW 16 32752220 missense probably benign 0.04
R0854:Muc4 UTSW 16 32778955 missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0864:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0926:Muc4 UTSW 16 32756196 unclassified probably benign
R0990:Muc4 UTSW 16 32752722 missense probably benign 0.00
R1127:Muc4 UTSW 16 32750525 missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32754529 missense probably benign 0.01
R1433:Muc4 UTSW 16 32753020 missense probably benign 0.00
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1506:Muc4 UTSW 16 32752233 missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32750349 missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1584:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1593:Muc4 UTSW 16 32754686 missense probably benign 0.00
R1601:Muc4 UTSW 16 32755501 unclassified probably benign
R1611:Muc4 UTSW 16 32750986 missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32756902 missense probably benign 0.11
R1822:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1824:Muc4 UTSW 16 32755933 unclassified probably benign
R1839:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1846:Muc4 UTSW 16 32752369 missense probably benign 0.01
R1864:Muc4 UTSW 16 32756251 unclassified probably benign
R1868:Muc4 UTSW 16 32756341 missense unknown
R1928:Muc4 UTSW 16 32750532 missense probably damaging 0.99
R1942:Muc4 UTSW 16 32750642 missense probably damaging 0.99
R2017:Muc4 UTSW 16 32751303 missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32752254 missense probably benign 0.00
R2081:Muc4 UTSW 16 32752220 missense probably benign 0.04
R2088:Muc4 UTSW 16 32756409 missense unknown
R2121:Muc4 UTSW 16 32760238 missense unknown
R2139:Muc4 UTSW 16 32761225 missense unknown
R2158:Muc4 UTSW 16 32754563 missense probably benign 0.10
R2165:Muc4 UTSW 16 32750476 missense probably damaging 0.96
R2210:Muc4 UTSW 16 32755176 frame shift probably null
R2225:Muc4 UTSW 16 32755891 unclassified probably benign
R2225:Muc4 UTSW 16 32766942 missense possibly damaging 0.73
R2269:Muc4 UTSW 16 32754529 missense probably benign 0.01
R2679:Muc4 UTSW 16 32757472 missense unknown
R3703:Muc4 UTSW 16 32753919 missense probably benign 0.10
R3816:Muc4 UTSW 16 32754529 missense probably benign 0.01
R3909:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4014:Muc4 UTSW 16 32755273 unclassified probably benign
R4065:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4249:Muc4 UTSW 16 32755826 unclassified probably benign
R4344:Muc4 UTSW 16 32770292 missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4393:Muc4 UTSW 16 32754529 missense probably benign 0.01
R4482:Muc4 UTSW 16 32756701 missense unknown
R4523:Muc4 UTSW 16 32736336 utr 5 prime probably benign
R4527:Muc4 UTSW 16 32755843 unclassified probably benign
R4572:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4587:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4614:Muc4 UTSW 16 32757058 missense probably benign 0.03
R4635:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4661:Muc4 UTSW 16 32769277 missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32755846 unclassified probably benign
R4730:Muc4 UTSW 16 32751214 missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32775903 missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32753625 unclassified probably benign
R4818:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4821:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4825:Muc4 UTSW 16 32751747 missense probably benign 0.41
R4830:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4860:Muc4 UTSW 16 32754616 missense probably benign 0.35
R4860:Muc4 UTSW 16 32754625 missense probably benign 0.18
R4869:Muc4 UTSW 16 32754836 unclassified probably benign
R4934:Muc4 UTSW 16 32756098 unclassified probably benign
R4959:Muc4 UTSW 16 32754319 missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32754572 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754214 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754041 missense probably benign 0.01
R4999:Muc4 UTSW 16 32756296 unclassified probably benign
R5073:Muc4 UTSW 16 32754529 missense probably benign 0.01
R5075:Muc4 UTSW 16 32754794 unclassified probably benign
R5152:Muc4 UTSW 16 32757058 nonsense probably null
R5161:Muc4 UTSW 16 32762521 missense probably damaging 0.98
R5174:Muc4 UTSW 16 32751738 missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32751666 missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32753919 missense probably benign 0.10
R5474:Muc4 UTSW 16 32761261 missense unknown
R5567:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32754253 missense probably benign 0.01
R5665:Muc4 UTSW 16 32750782 missense probably benign 0.33
R5667:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5671:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5693:Muc4 UTSW 16 32776807 missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32736241 nonsense probably null
R5708:Muc4 UTSW 16 32754769 unclassified probably benign
R5715:Muc4 UTSW 16 32751916 missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32774839 missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32751295 missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32751705 missense probably benign 0.41
R5933:Muc4 UTSW 16 32753052 missense probably benign 0.01
R5966:Muc4 UTSW 16 32756278 unclassified probably benign
R6062:Muc4 UTSW 16 32759308 missense unknown
R6067:Muc4 UTSW 16 32755247 unclassified probably benign
R6067:Muc4 UTSW 16 32754529 missense probably benign 0.01
R6078:Muc4 UTSW 16 32755247 unclassified probably benign
R6079:Muc4 UTSW 16 32755247 unclassified probably benign
R6112:Muc4 UTSW 16 32775783 missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32756795 missense unknown
R6144:Muc4 UTSW 16 32766924 missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32753802 missense probably benign 0.04
R6173:Muc4 UTSW 16 32736140 start gained probably benign
R6268:Muc4 UTSW 16 32768767 missense probably damaging 0.99
R6299:Muc4 UTSW 16 32752035 missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32753946 missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32754358 missense probably benign 0.19
R6361:Muc4 UTSW 16 32767351 missense probably benign 0.32
R6375:Muc4 UTSW 16 32736243 utr 5 prime probably benign
R6378:Muc4 UTSW 16 32778946 missense probably benign 0.33
R6418:Muc4 UTSW 16 32751789 missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32759320 critical splice donor site probably null
R6527:Muc4 UTSW 16 32753433 missense probably benign 0.01
R6616:Muc4 UTSW 16 32782008 missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6637:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6915:Muc4 UTSW 16 32766938 missense probably benign 0.18
R6947:Muc4 UTSW 16 32775803 missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32762518 missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32751999 missense probably benign 0.00
U15987:Muc4 UTSW 16 32754529 missense probably benign 0.01
U15987:Muc4 UTSW 16 32755247 unclassified probably benign
V5622:Muc4 UTSW 16 32751825 missense probably benign 0.00
X0018:Muc4 UTSW 16 32755481 unclassified probably benign
X0028:Muc4 UTSW 16 32759319 critical splice donor site probably null
Z1088:Muc4 UTSW 16 32756076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAAATGTTGTCAACCCTTCCTCAGAG -3'
(R):5'- TGGTTGTCTCACCATGAGAGATTGTTC -3'

Sequencing Primer
(F):5'- GAACAATCTCTCCTGGTGAGAC -3'
(R):5'- CACCATGAGAGATTGTTCTTTGAG -3'
Posted On2014-05-14