Incidental Mutation 'R1717:Morc1'
ID191165
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Namemicrorchidia 1
Synonyms
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1717 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48431237-48630900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48452477 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 156 (I156V)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
Predicted Effect probably benign
Transcript: ENSMUST00000023330
AA Change: I156V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: I156V

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Aldh4a1 A T 4: 139,638,529 H277L possibly damaging Het
Aldh4a1 G A 4: 139,633,994 probably null Het
Ankrd27 A G 7: 35,628,446 D742G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48612326 missense probably damaging 0.98
IGL00815:Morc1 APN 16 48460692 missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48452589 missense probably damaging 0.99
IGL01321:Morc1 APN 16 48582462 missense probably benign 0.00
IGL01410:Morc1 APN 16 48612314 missense probably benign 0.16
IGL01557:Morc1 APN 16 48498766 missense probably damaging 1.00
IGL02118:Morc1 APN 16 48587104 missense probably benign 0.01
IGL02626:Morc1 APN 16 48615760 missense probably damaging 0.96
IGL02692:Morc1 APN 16 48510233 missense probably null 0.95
IGL02812:Morc1 APN 16 48558506 splice site probably benign
IGL03232:Morc1 APN 16 48630802 missense probably benign 0.06
IGL03331:Morc1 APN 16 48612368 splice site probably benign
IGL03408:Morc1 APN 16 48442412 missense probably damaging 1.00
R0545:Morc1 UTSW 16 48565657 missense probably benign 0.05
R0569:Morc1 UTSW 16 48587122 missense probably benign 0.02
R0699:Morc1 UTSW 16 48592614 missense probably benign 0.01
R1728:Morc1 UTSW 16 48612297 missense probably benign 0.10
R1803:Morc1 UTSW 16 48622638 missense probably benign 0.14
R1864:Morc1 UTSW 16 48592530 missense probably benign 0.01
R2008:Morc1 UTSW 16 48565646 missense probably benign 0.41
R2070:Morc1 UTSW 16 48592611 missense probably benign 0.00
R2071:Morc1 UTSW 16 48592611 missense probably benign 0.00
R4851:Morc1 UTSW 16 48561617 missense probably benign 0.02
R5013:Morc1 UTSW 16 48502336 missense probably benign 0.11
R5081:Morc1 UTSW 16 48502352 missense probably benign 0.01
R5259:Morc1 UTSW 16 48630769 missense probably benign 0.12
R5342:Morc1 UTSW 16 48618509 missense probably damaging 0.99
R5481:Morc1 UTSW 16 48561485 intron probably null
R5561:Morc1 UTSW 16 48449348 missense probably benign 0.43
R6356:Morc1 UTSW 16 48437289 missense probably damaging 1.00
R6526:Morc1 UTSW 16 48587124 nonsense probably null
R6743:Morc1 UTSW 16 48502320 missense probably damaging 0.98
R6940:Morc1 UTSW 16 48479845 nonsense probably null
X0013:Morc1 UTSW 16 48587068 missense probably benign 0.04
X0027:Morc1 UTSW 16 48498811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAAGCACTGAGATTGTGGGC -3'
(R):5'- ACTCACACGGATAAAGTGAACGGC -3'

Sequencing Primer
(F):5'- cacacatacacacacacatacac -3'
(R):5'- TCATGCGATACTGCACCTGAG -3'
Posted On2014-05-14