Incidental Mutation 'R1718:Klk1b4'
ID191201
Institutional Source Beutler Lab
Gene Symbol Klk1b4
Ensembl Gene ENSMUSG00000066513
Gene Namekallikrein 1-related pepidase b4
SynonymsNgfa, mGk-4, Ngfa
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44207435-44211754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44209672 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 38 (Y38C)
Ref Sequence ENSEMBL: ENSMUSP00000076576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077354]
PDB Structure
CRYSTAL STRUCTURE OF 7S NGF: A COMPLEX OF NERVE GROWTH FACTOR WITH FOUR BINDING PROTEINS (SERINE PROTEINASES) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000077354
AA Change: Y38C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076576
Gene: ENSMUSG00000066513
AA Change: Y38C

DomainStartEndE-ValueType
Tryp_SPc 10 248 5.88e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206046
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Klk1b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Klk1b4 APN 7 44211032 splice site probably benign
IGL00572:Klk1b4 APN 7 44210774 missense possibly damaging 0.79
IGL01314:Klk1b4 APN 7 44211176 critical splice donor site probably null
IGL02252:Klk1b4 APN 7 44210670 nonsense probably null
IGL03006:Klk1b4 APN 7 44211595 missense probably benign 0.08
R0255:Klk1b4 UTSW 7 44210734 missense probably benign 0.00
R0277:Klk1b4 UTSW 7 44211629 missense possibly damaging 0.78
R0931:Klk1b4 UTSW 7 44211056 missense probably damaging 1.00
R1777:Klk1b4 UTSW 7 44207451 start gained probably benign
R1894:Klk1b4 UTSW 7 44209630 missense probably benign
R1924:Klk1b4 UTSW 7 44209681 missense probably benign 0.00
R3979:Klk1b4 UTSW 7 44211593 missense probably damaging 1.00
R4044:Klk1b4 UTSW 7 44210755 missense probably benign 0.03
R5011:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R5013:Klk1b4 UTSW 7 44211068 missense probably benign 0.01
R5794:Klk1b4 UTSW 7 44209645 missense probably damaging 0.99
R7122:Klk1b4 UTSW 7 44211107 missense not run
Predicted Primers PCR Primer
(F):5'- TTGATCTCCCTATCGAGGACCAGC -3'
(R):5'- AGAGTTTCAGCCAGTTCCACCTGC -3'

Sequencing Primer
(F):5'- ATATATGGGTCCCTTCCCCAGATG -3'
(R):5'- AGTTCCACCTGCCTGCC -3'
Posted On2014-05-14