Incidental Mutation 'R1718:Rnf141'
List |< first << previous [record 49 of 65] next >> last >|
ID191204
Institutional Source Beutler Lab
Gene Symbol Rnf141
Ensembl Gene ENSMUSG00000030788
Gene Namering finger protein 141
Synonyms2610110L04Rik, ZFP36, ZNF230
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1718 (G1)
Quality Score126
Status Validated
Chromosome7
Chromosomal Location110800432-110844457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110821273 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 175 (Q175K)
Ref Sequence ENSEMBL: ENSMUSP00000134781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106682] [ENSMUST00000175981] [ENSMUST00000176746] [ENSMUST00000177236] [ENSMUST00000177462]
Predicted Effect probably damaging
Transcript: ENSMUST00000106682
AA Change: Q175K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788
AA Change: Q175K

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000175648
AA Change: Q4K
Predicted Effect possibly damaging
Transcript: ENSMUST00000175981
AA Change: Q78K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788
AA Change: Q78K

DomainStartEndE-ValueType
RING 58 94 3.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176048
Predicted Effect unknown
Transcript: ENSMUST00000176210
AA Change: Q22K
Predicted Effect probably benign
Transcript: ENSMUST00000176746
Predicted Effect probably damaging
Transcript: ENSMUST00000177236
AA Change: Q175K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788
AA Change: Q175K

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177462
AA Change: Q175K

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788
AA Change: Q175K

DomainStartEndE-ValueType
PDB:2ECN|A 144 180 3e-21 PDB
SCOP:d1fbva4 146 180 3e-7 SMART
Blast:RING 155 180 6e-12 BLAST
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Rnf141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rnf141 APN 7 110833734 unclassified probably benign
IGL02246:Rnf141 APN 7 110825287 missense probably benign
IGL02336:Rnf141 APN 7 110837198 nonsense probably null
R0482:Rnf141 UTSW 7 110837138 nonsense probably null
R1324:Rnf141 UTSW 7 110816843 nonsense probably null
R2067:Rnf141 UTSW 7 110821365 splice site probably benign
R4151:Rnf141 UTSW 7 110837199 missense probably benign 0.19
R4867:Rnf141 UTSW 7 110816768 missense probably damaging 1.00
R4869:Rnf141 UTSW 7 110825350 missense probably damaging 1.00
R4947:Rnf141 UTSW 7 110825320 missense possibly damaging 0.66
R5320:Rnf141 UTSW 7 110833803 missense probably damaging 1.00
R6364:Rnf141 UTSW 7 110821309 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGTGTCAAAGCCCTGCTGCATC -3'
(R):5'- GCATCCATGTGTCCCTTATGGCAAG -3'

Sequencing Primer
(F):5'- GCATCCCCACACTTCACTG -3'
(R):5'- TGCTATGCCCAAAAGATGGTC -3'
Posted On2014-05-14