Incidental Mutation 'R1718:Glra3'
List |< first << previous [record 19 of 65] next >> last >|
ID191206
Institutional Source Beutler Lab
Gene Symbol Glra3
Ensembl Gene ENSMUSG00000038257
Gene Nameglycine receptor, alpha 3 subunit
Synonyms
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location55940460-56130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55940907 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 18 (A18S)
Ref Sequence ENSEMBL: ENSMUSP00000000275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000275]
Predicted Effect probably benign
Transcript: ENSMUST00000000275
AA Change: A18S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000000275
Gene: ENSMUSG00000038257
AA Change: A18S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 269 3.7e-55 PFAM
Pfam:Neur_chan_memb 276 434 1.4e-35 PFAM
PDB:2M6I|E 437 474 1e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164020
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are fertile and display decreased inflammatory pain sensitization without any gross abnormalities in the brain or spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Glra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Glra3 APN 8 55940977 splice site probably benign
IGL01301:Glra3 APN 8 55940962 missense probably benign 0.00
IGL01772:Glra3 APN 8 56089055 missense probably benign 0.22
IGL02280:Glra3 APN 8 55940971 missense possibly damaging 0.67
IGL02386:Glra3 APN 8 56089028 missense probably benign 0.12
IGL02508:Glra3 APN 8 56085144 missense probably benign 0.10
IGL03094:Glra3 APN 8 56125172 missense probably benign
ANU18:Glra3 UTSW 8 55940962 missense probably benign 0.00
R0532:Glra3 UTSW 8 56125076 missense probably benign
R0708:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0710:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0927:Glra3 UTSW 8 56125204 missense possibly damaging 0.65
R1125:Glra3 UTSW 8 56039754 missense possibly damaging 0.69
R1138:Glra3 UTSW 8 56088976 splice site probably null
R1717:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1848:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1933:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1934:Glra3 UTSW 8 55940907 missense probably benign 0.07
R2042:Glra3 UTSW 8 56062459 missense probably benign 0.36
R2571:Glra3 UTSW 8 56110481 missense probably benign 0.41
R3123:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R3124:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R4585:Glra3 UTSW 8 56088993 missense probably damaging 1.00
R4593:Glra3 UTSW 8 55940881 missense probably damaging 1.00
R4981:Glra3 UTSW 8 55991235 missense possibly damaging 0.69
R5277:Glra3 UTSW 8 55991207 missense possibly damaging 0.79
R5356:Glra3 UTSW 8 55940901 missense probably benign 0.00
R6214:Glra3 UTSW 8 55991256 splice site probably null
R6941:Glra3 UTSW 8 55940926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGTTGCTCAGGACCTCTGCAC -3'
(R):5'- GTGGGAAGAGCCCAACTACTCAAAC -3'

Sequencing Primer
(F):5'- GTAGCTTCACTGTGAAATCACTCG -3'
(R):5'- GTTTCAGTAAGTCAGAACACAGTCC -3'
Posted On2014-05-14