Incidental Mutation 'R1718:Olfr250'
List |< first << previous [record 40 of 65] next >> last >|
ID191212
Institutional Source Beutler Lab
Gene Symbol Olfr250
Ensembl Gene ENSMUSG00000049864
Gene Nameolfactory receptor 250
SynonymsGA_x6K02T2MYUG-19447-18473, MOR170-14
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38366896-38371355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38367594 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 6 (D6G)
Ref Sequence ENSEMBL: ENSMUSP00000150432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052085] [ENSMUST00000216168]
Predicted Effect probably benign
Transcript: ENSMUST00000052085
AA Change: D16G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051631
Gene: ENSMUSG00000049864
AA Change: D16G

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.2e-46 PFAM
Pfam:7tm_1 51 300 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216168
AA Change: D6G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Olfr250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Olfr250 APN 9 38368050 missense probably benign 0.01
IGL02073:Olfr250 APN 9 38368307 missense probably damaging 1.00
IGL02499:Olfr250 APN 9 38367681 missense probably benign 0.12
IGL03011:Olfr250 APN 9 38368068 missense possibly damaging 0.89
R0313:Olfr250 UTSW 9 38368304 missense probably damaging 1.00
R1457:Olfr250 UTSW 9 38368196 missense probably benign 0.01
R1546:Olfr250 UTSW 9 38367548 start codon destroyed probably benign
R1665:Olfr250 UTSW 9 38367566 missense probably benign
R1861:Olfr250 UTSW 9 38367606 missense probably benign 0.08
R1900:Olfr250 UTSW 9 38368064 missense probably benign 0.05
R2363:Olfr250 UTSW 9 38368098 missense probably damaging 1.00
R4270:Olfr250 UTSW 9 38367701 missense probably damaging 1.00
R5058:Olfr250 UTSW 9 38367924 missense probably damaging 1.00
R5083:Olfr250 UTSW 9 38368062 missense possibly damaging 0.87
R5422:Olfr250 UTSW 9 38367974 missense probably benign 0.05
R5630:Olfr250 UTSW 9 38368106 missense probably damaging 1.00
R6559:Olfr250 UTSW 9 38367756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCAACAAGCCCCTGGATG -3'
(R):5'- GCTGTCAGCACATAGCACTCAGAG -3'

Sequencing Primer
(F):5'- AGTCCCATTCATGACTGGAGG -3'
(R):5'- ATAGCTGAGTCATGCATCCTG -3'
Posted On2014-05-14